(last modified November 18, 2005)
gamma-Sarcoglycan was first described by Ervasti et al. as a 35 kD protein which was associated with dystrophin. Noguchi first reported the cloning of the gamma-sarcoglycan gene and its involverment in severe childhood autosomal recessive muscular dystrophy (SCARMD or limb-girdle muscular dystrophy type 2F (LGMD2C). Segregation of human chromosome 13 markers was first documented in a number of Tunesian kindreds Ben Othmane. The gamma-sarcoglycan gene maps to chromosome 13q12, it spans over 100 kb of genomic DNA and contains 8 exons (GenBank accession numbers U63388-U63395, McNally). gamma-Sarcoglycan is a 291 amino acid protein containing a 35 amino acid intra-cellulair N-terminal region, a 25 amino acid transmembrane region and a 231 amino acid extra-cellular C-terminus. The most frequently occuring variation (525delT) is usually, but not exclusively, found on the 122 bp allele of D13S232 (McNally), while the Cys283Tyr variation is found on the 112 bp allele (allele 5) in Gypsies (Piccolo). In the muscle membrane of SCARMD patients gamma-sarcoglycan is absent and alpha- and ß-sarcoglycan are deficient, i.e. show reduced staining.
Links to other databases:
Gene
Symbol nomenclature LocusLink OMIM Gene Map
GDB
gamma-Sarcoglycan (Gene Symbol SGCG, aliases DMDA1, SCG3, A4, DAGA4, MAM) sequences were cloned first by Noguchi et al from a rabbit expression cDNA library using monoclonal antibody MA4-2. Human cDNA's were isolated with the insert of this rabbit cDNA clone. The gamma-sarcoglycan gene maps to chromosome 13q12, it spans 144 kb of genomic DNA and contains 8 exons (McNally). Exons 1 and 8 include the 5' and 3' untranslated regions respectively. The SGCG gene is flanked centromieric by the FGF9 and PLIF (AY033611, opposite transcriptional orientation) genes and telomeric by the sacsin (SACS, opposite transcriptional organisation, directly 3') and TNFRSF19 genes.
| Exon | Exon size (bp) | Intron size (kb) | 5' cDNA position | Splice after | Remarks |
|---|---|---|---|---|---|
| 1 | 124 | 22,619 | -185 | - | 5' UTR |
| 2 | 195 | 30,721 | 1 | 0 | with TMR |
| 3 | 102 | 15,917 | 196 | 0 | |
| 4 | 88 | 28,641 | 298 | 1 | Asn110 N-Glyco |
| 5 | 120 | 15,936 | 386 | 1 | |
| 6 | 73 | 25,149 | 506 | 2 | |
| 7 | 123 | 3,607 | 579 | 2 | |
| 8 | 805 | - | 702 | - | 174 bp coding / 3' UTR |
NOTE: exon 1 was not present in SGCG gene as reported by .....
Legend:
Exon: numbering of exons and intron/exon boundaries are according to Noguchi et al., with the first base of the Met-codon counted as
position 1 (see Reference sequence). Exon size:
size of exon indicated in basepairs. Intron size: size of intron indicated in
kilobasepairs. 5' cDNA position: first base of the exon (according to cDNA sequence
U34976, McNally). Splice after: splicing occurs in
between of two coding triplets (0), after the first (1) or the second (2) base of a
triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region,
N-Glyco = potential Asparagine-linked glycosylation site, TMR = transmembrane region.
Links to other databases: RefSeq: NM_000231 UniGene: Hs.37167
gamma-Sarcoglycan mRNA is expressed exclusively in striated muscle (Noguchi).
Links to other databases: RefSeq: NP_000222
gamma-Sarcoglycan (SGCG) is a basic 35 kDa protein of 291 amino acids with a calculated molecular weght of 32,221 kDa (theoretical pI ....5.0). It is considered a type II transmembrane protein with a 37 amino acid intra-cellular N-terminal domain, a single 21 amino acid transmembrane domain (amino acids Leu38-Leu58) and a 233 amino acid extra-cellular carboxyl terminus (amino acids Lys59-Leu291). gamma-Sarcoglycan lacks an N-terminal signal sequence and has charged residues at amino acids 32 to 34 (RKR). The cytoplasmic domain contains a potential asparagine-linked glycosylation site (Asn110). The extra-cellular domain contains four conserved Cys-residues (Cys265, Cys267, Cys283 and Cys290).
Human and rabbit gamma-sarcoglycan are highly conserved with a 89% identity and 93% similarity at the amino acid level. gamma-Sarcoglycan is also homologous to delta-sarcoglycan (55% amino acid identity / 70% similarity), ß-sarcoglycan (23% amino acid identity / 51% homology) and C.elegans clone F07H5.2. A weak homology was noted between the Cysteine-containing region of these sarcoglycans and the a so called "EGF-like cysteine containing repeat" of proteins like the LDL-receptor, laminin-A1 and fibrillin (McNally, consensus xCxCPxG[x]5-15C).
Links to other databases: OMIM: 253700
Segregation of human chromosome 13 markers was first documented in a number of Tunesian kindreds Ben Othmane. A strong linkage disequilibrium was observed with D13S232 (Ben Othmane 1995, Am.J.Hum.Genet. 57:732). Later, linkage to 13q12 was also confirmed for non-North African families.
Noguchi et al. reported the first variations in the gamma-sarcoglycan gene in patients with severe childhood autosomal recessive muscular dystrophy (SCARMD). The most frequently occuring variation (525delT) is usually, but not exclusively, found on the 122 bp allele of D13S232 (McNally), while the Cys283Tyr variation found in Gypsies segregates with the 112 bp allele (allele 5) (Piccolo).
In the muscle membrane of SCARMD patients gamma-sarcoglycan is absent and alpha- and ß-sarcoglycan are deficient, i.e. show reduced staining. Duggan et al. detected in muscle biopsies from a set of 263 patients with muscle weakness and normal dystrophin content, 50 unrelated cases with an abnormal (i.e. partially or completely absent) alpha- sarcoglycan staining (McNally). In four of these cases, variations were identified in the gamma-sarcoglycan gene.
Merlini et al. (2001, Acta Myologica XX: 188-191) have published a detailed study of the phenotype of the 848G>A (Cys283Tyr) mutation from 68 Gypsy patients (36 men, 32 women) belonging to 35 families living in 6 different European countries (4 from France, 4 from Spain, 2 from Deutschland, 2 from Potugal, 2 from Italia and 21 from Bulgaria). Clinical examination and muscle imaging showed an early selective involvement of the glutei, adductors, hamstrings, spinalis, abdominals, subscapularis and soleus and a long-lasting sparing of the quadriceps. 50% of patients had a severe progression like in DMD patients, 25% had an intermediate (IMD) phenotype and 25% had a BMD-like phenotype. Mental retardation and dilated cardiomyopathy were not observed.
The SGCG:c.521delT mutation is found most frequently, found nearly exclusively on one haplotype, originating from African ancestries (McNally [1996]).
Hack et al. disrupted the murine gamma-sarcoglycan gene using homologous recombination. Mice lacking gamma-sarcoglycan showed pronounced dystrophic muscle changes in early life. By 20 weeks of age, the mice developed cardiomyopathy and died prematurely. The loss of gamma-sarcoglycan produced secondary reduction of beta- and delta-sarcoglycan with partial retention of alpha- and epsilon-sarcoglycan. This suggests that beta-, gamma-, and delta-sarcoglycan function as a unit. The mice showed normal dystrophin content and localization, demonstrating that myofiber degeneration occurred independently of dystrophin alteration. Furthermore, beta-dystroglycan and laminin were left intact, implying that the dystrophin-dystroglycan-laminin mechanical link was unaffected by sarcoglycan deficiency. Apoptotic myonuclei were abundant in skeletal muscle lacking gamma-sarcoglycan, suggesting that programmed cell death contributes to myofiber degeneration. Vital staining with Evans blue dye revealed that muscle lacking gamma-sarcoglycan developed membrane disruptions like those seen in dystrophin-deficient muscle.
Primers for DHPLC-analysis of the SGCG-gene, have also been published.
| Amplified | Reference | Length | forward primer | reverse primer | Name |
|---|---|---|---|---|---|
| exon 1 | McNally | 400 | ctatcatgctttagggtttaaatg | tctaagttaaaactgagcactt | |
| exon 2 | McNally | 256 | ctctctcctctcgtgaacacactc | catgcttaccagaaaataatgatac | |
| exon 3 | McNally | 166 | tacgcattgtctcttttttttttttaac | aaagcacaaattatttgtcttaac | |
| exon 4 | McNally | 150 | cagcacctattttgcaaattttataaatc | gcaccatgatgaagctggactc | |
| exon 5 | McNally | 229 | gttgacgtggcatgtgtaaaa | gttgtgtttttctcgagttagtac | |
| exon 6 | McNally | 198 | tggtgtcacttattttacttctgc | ctaacattattccagcacatacc | |
| exon 7 | McNally | 181 | ttttgtgcttcttttcctcatctc | cagtaggaggctgatctgtga | |
| exon 8 | McNally | 319 | ccttaactcttcgtctcccatctt | gcgtttac(g/t)tcccatccacgctgcc |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to Noguchi et al. . Length: length of
PCR-product in basepairs. Reference: publication describing the primer(s). Forward
primer: sequence of forward primer. Reverse primer: sequence of reverse primer.
Name: name of the primers.
| Amplified | Reference | Length | Forward primer | Reverse primer | Name |
|---|---|---|---|---|---|
| -129-195 | Noguchi | 324 | CATTCTGTCTGTGGTAGAGCTCGG | TGGAGAAAACCACATCACTTTAAGAA | P-1F/4R |
| -42-476 | Nowak | 518 | AGCTGTAGTTCATTCGCCAG | ACAACTTCCTTCTCATCTACAG | cDNA1 |
| 121-515 | Noguchi | 395 | CTTCTTTTACTCATCATCCTCGT | CCTTCAGGCCCAGTTACTCGAAG | P-3F/6R |
| 392-589 | McNally | 198 | AAATGGTAGAAGTCCAGAATCAACA | GGGATTCTAATCTAAGGTCTTGA | P-5F/14R |
| 392-722 | McNally | 331 | AAATGGTAGAAGTCCAGAATCAACA | GTTTCAGCATCAAGCACAAGCATTCC | P-5F/7R |
| 395-910 | Nowak | 516 | TGGTAGAAGTCCAGAATCAAC | GCACTGCACAGCTCACCGAG | cDNA2 |
| 596-986 | Noguchi | 391 | GGAGTCTAAGCATGGATGCCCCAA | GCGTTTACTTCCCATCCACGCTGC | P-8F/10R |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to Roberds et al.. Length: length of
PCR-product in basepairs. Reference: publication describing the primer(s). Forward
primer: sequence of forward primer. Reverse primer: sequence of reverse primer.
Name: name of the primers.
| Top of page | LMDp homepage
|
| Sarcoglycan homepage | SGC-homlogies
| SGC-alpha, SGC-beta,
SGC-delta, SGC-epsilon,
SGC-zeta |
| Remarks / information | Disclaimer
|