Protein O-linked Mannose beta1,2-N-acetylGlucosaminylTransferase (POMGNT1) - coding DNA reference sequence

(used for mutation description)

(last modified January 17, 2013)


This file was created to facilitate the description of sequence variants in the POMGNT1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_009205.2, covering POMGNT1 transcript variant-2 (NM_001243766.1). Transcript variant-1 (NM_017739.3) uses a different promoter/first exon (exon 1b) located in intron 1, an alternative splice site in intron 21 (exon 21b) and does not splice out intron 22.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
           .         .         .         .         .                g.5051
          ctcagactgagggagaatcaattttgggggagaccacatctaatggataaa       c.-601

 .         .         .         .         .         .                g.5111
 agagccacaggattacaaaagggtggaatagttgttacaagaaggtcacatcatcctggc       c.-541

 .         .         .         .         .         .                g.5171
 actgctcccagaaccagtgggcctcgaagcccagcttggcactctcatcctctggtgact       c.-481

 .         .         .         .         .         .                g.5231
 caggtggtccaccttgaagcctctcccctgggggcttccacacagctctcaagctcccta       c.-421

 .         .         .         .         .         .                g.5291
 gcctggtggctgccacatccacctcagtcctggccctctctccaccagctataacttttg       c.-361

 .         .         .         .         .         .                g.5351
 cccagtccatctcggaacgtggagccccaggtgggccctgttcatccagctcgctggggg       c.-301

 .         .         .         .         .         .                g.5411
 ccactgtgtccaggaagctgccaatagagacactgtccagccggtcggtggtgctggtgt       c.-241

 .         .         .         .         .         .                g.5471
 ctggcaggctgtcccagctgcctcgccttgagcggcctgggctcccgcctgtcaggctat       c.-181

 .         .         .         .         .         .                g.5531
 attgactgctggtgaggctgctgcaatgactggtcaacgtcccccgctcctccaacagcc       c.-121

 .         .         .         .         .         .                g.5591
 agcgcactgcctcgatgccctcattcaaggtcaccagctgctgcaggatcttcacatcga       c.-61

 .          | 02        .         .         .         .             g.27484
 tggctcgcag | attcctgaagtcatgggctggccaggacattggtgacccgccaatccggt    c.-1
            ^  alternative promoter/first exon 1b

          .         .         .         .         .         .       g.27544
 ATGGACGACTGGAAGCCCAGCCCCCTCATCAAGCCCTTTGGGGCTCGGAAGAAGCGGAGC       c.60
 M  D  D  W  K  P  S  P  L  I  K  P  F  G  A  R  K  K  R  S         p.20

          .         .         .         .         .         .       g.27604
 TGGTACCTTACCTGGAAGTATAAACTGACAAACCAGCGGGCCCTGCGGAGATTCTGTCAG       c.120
 W  Y  L  T  W  K  Y  K  L  T  N  Q  R  A  L  R  R  F  C  Q         p.40

  | 03       .         .         .         .         .         .    g.28281
  | ACAGGGGCCGTGCTTTTCCTGCTGGTGACTGTCATTGTCAATATCAAGTTGATCCTGGAC    c.180
  | T  G  A  V  L  F  L  L  V  T  V  I  V  N  I  K  L  I  L  D      p.60

          .         .         .         .         .      | 04  .    g.28461
 ACTCGGCGAGCCATCAGTGAAGCCAATGAAGACCCAGAGCCAGAGCAAGACTATG | ATGAG    c.240
 T  R  R  A  I  S  E  A  N  E  D  P  E  P  E  Q  D  Y  D |   E      p.80

          .         .         .         .         .         .       g.28521
 GCCCTAGGCCGCCTGGAGCCCCCACGGCGCAGAGGCAGTGGTCCCCGGCGGGTCCTGGAC       c.300
 A  L  G  R  L  E  P  P  R  R  R  G  S  G  P  R  R  V  L  D         p.100

          .         .         .         .         .     | 05   .    g.29234
 GTAGAGGTGTATTCAAGTCGCAGCAAAGTATATGTGGCAGTGGATGGCACCACG | GTGCTG    c.360
 V  E  V  Y  S  S  R  S  K  V  Y  V  A  V  D  G  T  T   | V  L      p.120

          .         .         .         .         .         .       g.29294
 GAGGATGAGGCCCGGGAGCAGGGCCGGGGCATCCATGTCATTGTCCTCAACCAGGCCACG       c.420
 E  D  E  A  R  E  Q  G  R  G  I  H  V  I  V  L  N  Q  A  T         p.140

  | 06       .         .         .         .         .         .    g.29441
  | GGCCACGTGATGGCAAAACGTGTGTTTGACACGTACTCACCTCATGAGGATGAGGCCATG    c.480
  | G  H  V  M  A  K  R  V  F  D  T  Y  S  P  H  E  D  E  A  M      p.160

          .         .         .         .         .     | 07   .    g.30350
 GTGCTATTCCTCAACATGGTAGCGCCCGGCCGAGTGCTCATCTGCACTGTCAAG | GATGAG    c.540
 V  L  F  L  N  M  V  A  P  G  R  V  L  I  C  T  V  K   | D  E      p.180

          .         .         .         .         .         .       g.30410
 GGCTCCTTCCACCTCAAGGACACAGCCAAGGCTCTGCTGAGGAGCCTGGGCAGCCAGGCT       c.600
 G  S  F  H  L  K  D  T  A  K  A  L  L  R  S  L  G  S  Q  A         p.200

          .         .         .         .         .   | 08     .    g.30662
 GGCCCTGCCCTGGGCTGGAGGGACACATGGGCCTTCGTGGGACGAAAAGGAG | GTCCTGTC    c.660
 G  P  A  L  G  W  R  D  T  W  A  F  V  G  R  K  G  G |   P  V      p.220

          .         .         .         .         .         .       g.30722
 TTCGGGGAGAAACATTCTAAATCACCTGCCCTCTCTTCCTGGGGGGACCCAGTCCTGCTG       c.720
 F  G  E  K  H  S  K  S  P  A  L  S  S  W  G  D  P  V  L  L         p.240

          .         .         .  | 09      .         .         .    g.30933
 AAGACAGATGTGCCATTGAGCTCAGCAGAAG | AGGCAGAGTGCCACTGGGCAGACACAGAG    c.780
 K  T  D  V  P  L  S  S  A  E  E |   A  E  C  H  W  A  D  T  E      p.260

          .         .         .         .         .         .       g.30993
 CTGAACCGTCGCCGCCGGCGCTTCTGCAGCAAAGTTGAGGGCTATGGAAGTGTATGCAGC       c.840
 L  N  R  R  R  R  R  F  C  S  K  V  E  G  Y  G  S  V  C  S         p.280

          .         .         .          | 10        .         .    g.31401
 TGCAAGGACCCCACACCCATCGAGTTCAGCCCTGACCCA | CTCCCAGACAACAAGGTCCTC    c.900
 C  K  D  P  T  P  I  E  F  S  P  D  P   | L  P  D  N  K  V  L      p.300

          .         .         .         .         . | 11       .    g.31676
 AATGTGCCTGTGGCTGTCATTGCAGGGAACCGACCCAATTACCTGTACAG | GATGCTGCGC    c.960
 N  V  P  V  A  V  I  A  G  N  R  P  N  Y  L  Y  R  |  M  L  R      p.320

          .         .         .         .         .         .       g.31736
 TCTCTGCTTTCAGCCCAGGGGGTGTCTCCTCAGATGATAACAGTTTTCATTGACGGCTAC       c.1020
 S  L  L  S  A  Q  G  V  S  P  Q  M  I  T  V  F  I  D  G  Y         p.340

        | 12 .         .         .         .         .         .    g.31971
 TATGAG | GAACCCATGGATGTGGTGGCACTGTTTGGTCTGAGGGGCATCCAGCATACTCCC    c.1080
 Y  E   | E  P  M  D  V  V  A  L  F  G  L  R  G  I  Q  H  T  P      p.360

          .         .         . | 13       .         .         .    g.32120
 ATCAGCATCAAGAATGCCCGCGTGTCTCAG | CACTACAAGGCCAGCCTCACTGCCACTTTC    c.1140
 I  S  I  K  N  A  R  V  S  Q   | H  Y  K  A  S  L  T  A  T  F      p.380

          .   | 14     .         .         .         .         .    g.32395
 AACCTGTTTCCG | GAGGCCAAGTTTGCTGTGGTTCTGGAAGAGGACCTGGACATTGCTGTG    c.1200
 N  L  F  P   | E  A  K  F  A  V  V  L  E  E  D  L  D  I  A  V      p.400

          .  | 15      .         .         .         .         .    g.32764
 GATTTTTTCAG | TTTCCTGAGCCAATCCATCCACCTACTGGAGGAGGATGACAGCCTGTAC    c.1260
 D  F  F  S  |  F  L  S  Q  S  I  H  L  L  E  E  D  D  S  L  Y      p.420

          .         .     | 16   .         .         .         .    g.32905
 TGCATCTCTGCCTGGAATGACCAG | GGGTATGAACACACGGCTGAGGACCCAGCACTACTG    c.1320
 C  I  S  A  W  N  D  Q   | G  Y  E  H  T  A  E  D  P  A  L  L      p.440

          .         .         .         .         .         .       g.32965
 TACCGTGTGGAGACCATGCCTGGGCTGGGCTGGGTGCTCAGGAGGTCCTTGTACAAGGAG       c.1380
 Y  R  V  E  T  M  P  G  L  G  W  V  L  R  R  S  L  Y  K  E         p.460

          .         .         .    | 17    .         .         .    g.33109
 GAGCTTGAGCCCAAGTGGCCTACACCGGAAAAG | CTCTGGGATTGGGACATGTGGATGCGG    c.1440
 E  L  E  P  K  W  P  T  P  E  K   | L  W  D  W  D  M  W  M  R      p.480

          .         .         .         .         .         .       g.33169
 ATGCCTGAACAACGCCGGGGCCGAGAGTGCATCATCCCTGACGTTTCCCGATCCTACCAC       c.1500
 M  P  E  Q  R  R  G  R  E  C  I  I  P  D  V  S  R  S  Y  H         p.500

          .         .         .          | 18        .         .    g.34542
 TTTGGCATCGTCGGCCTCAACATGAATGGCTACTTTCAC | GAGGCCTACTTCAAGAAGCAC    c.1560
 F  G  I  V  G  L  N  M  N  G  Y  F  H   | E  A  Y  F  K  K  H      p.520

          .         .         .         .     | 19   .         .    g.34804
 AAGTTCAACACGGTTCCAGGTGTCCAGCTCAGGAATGTGGACAG | TCTGAAGAAAGAAGCT    c.1620
 K  F  N  T  V  P  G  V  Q  L  R  N  V  D  S  |  L  K  K  E  A      p.540

          .         .          | 20        .         .         .    g.35347
 TATGAAGTGGAAGTTCACAGGCTGCTCAG | TGAGGCTGAGGTTCTGGACCACAGCAAGAAC    c.1680
 Y  E  V  E  V  H  R  L  L  S  |  E  A  E  V  L  D  H  S  K  N      p.560

          .         .         .         .         .         .       g.35407
 CCTTGTGAAGACTCTTTCCTGCCAGACACAGAGGGCCACACCTACGTGGCCTTTATTCGA       c.1740
 P  C  E  D  S  F  L  P  D  T  E  G  H  T  Y  V  A  F  I  R         p.580

          .         .         .         .      | 21  .         .    g.35753
 ATGGAGAAAGATGATGACTTCACCACCTGGACCCAGCTTGCCAAG | TGCCTCCATATCTGG    c.1800
 M  E  K  D  D  D  F  T  T  W  T  Q  L  A  K   | C  L  H  I  W      p.600

          .         .         .         .         .         .       g.35813
 GACCTGGATGTGCGTGGCAACCATCGGGGCCTGTGGAGATTGTTTCGGAAGAAGAACCAC       c.1860
 D  L  D  V  R  G  N  H  R  G  L  W  R  L  F  R  K  K  N  H         p.620

           | 22        .         .         .         .         .    g.35999
 TTCCTGGTG | AGTGAAGAAGCCACCCTCAGTCACCCCAATTTTCCTGGAGCCACCCCCAAA    c.1920
 F  L  V   | S  E  E  A  T  L  S  H  P  N  F  P  G  A  T  P  K      p.640
           ^  alternatively spliced exon 21b
              V  K  K  P  P  S  V  T  P  I  F  L  E  P  P  P  K     p.623+26
              alternative reading frame transcript variant-1

          .         .         .         .         .         .       g.36059
 GGAGGAGGGAGCCCCAGGAGCCCCAGAACAGACATGAGACCTCCTCCAGGACCCTGCGGG       c.1980
 G  G  G  S  P  R  S  P  R  T  D  M  R  P  P  P  G  P  C  G         p.660
  E  E  G  A  P  G  A  P  E  Q  T  *                                p.623+37

       | 23  .         .         .         .         .         .    g.36380
 GCTGG | GCCTGGCTCAGAATCTAACCTATTTATTGACTGTCCTGAGGGCCTTGAAAACAGG    c.2040
 A  G  |  P  G  S  E  S  N  L  F  I  D  C  P  E  G  L  E  N  R      p.680
       ^  intron 22 not spliced in transcript variant-1

          .         .         .         .         .         .       g.36440
 CCGAACCTGGAGGGCCTGGATTTCTTTTTGGGCTGGAATGCTGCCCTGAGGGTGGGGCTG       c.2100
 P  N  L  E  G  L  D  F  F  L  G  W  N  A  A  L  R  V  G  L         p.700

          .         .         .         .         .         .       g.36500
 GCTCTTACTCAGGAAACTGCTGTGCCCAACCCATGGACAGGCCCAGCTGGGGCCCACATG       c.2160
 A  L  T  Q  E  T  A  V  P  N  P  W  T  G  P  A  G  A  H  M         p.720

          .         .         .         .         .         .       g.36560
 CTGACACAGACTCACTCAGAGACCCTTAGACACTGGACCAGGCCTCCTCTCAGCCTTCTC       c.2220
 L  T  Q  T  H  S  E  T  L  R  H  W  T  R  P  P  L  S  L  L         p.740

          .         .                                               g.36587
 TTTGTCCAGATTTCCAAAGCTGGATAA                                        c.2247
 F  V  Q  I  S  K  A  G  *                                          p.748

          .         .         .                                     g.36625
 gttggtcattgattaaaaaaggagaagccctctgggga                             c.*38

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Protein O-linked Mannose beta1,2-N-acetylGlucosaminylTransferase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 34
2004-2012 Leiden University Medical Center