Protein O-linked Mannose beta1,2-N-acetylGlucosaminylTransferase (POMGNT1) - 126 nt intron 21 reference sequence

(intronic numbering for coding DNA Reference Sequence)

contains 3' end alternatively spliced exon 21b



         .         .       |    .         .         .         .  g.35882
gtgggggtcccggcttccccctactc | gtgagtgacccttttctgccctgggaaacaggag  c.1869+60
V  G  V  P  A  S  P  Y  S  |                                     p.623+9
^  alternatively spliced exon 21b


     g.35885
gcc  c.1869+63

--------------------- middle of intron ---------------------
                                              g.35886         g.35888
                                              c.1870-63  tag  c.1870-61

.         .         .         .         .         .           g.35948
tgagatccagggatatagctaatggcttcttctctatacattcttgtattattttcccag  c.1870-1


Powered by LOVD v.2.0 Build 34
2004-2012 Leiden University Medical Center