Protein O-linked Mannose beta1,2-N-acetylGlucosaminylTransferase (POMGNT1) - 261 nt intron 22 reference sequence

(intronic numbering for coding DNA Reference Sequence)

NOTE: intron not spliced in transcript variant-1


         .         .         .         .         .         .  g.36124
gtactgtgtacccccaggctggctagcccttccctccatcctgtaggattttgtagatgc  c.1985+60

         .         .         .         .         .         .  g.36184
tggtaggggctggggctaccttgtttttaacatgagacttaattactaactccaagggga  c.1985+120

         .   g.36195
gggttcccctg  c.1985+131

--------------------- middle of intron ---------------------
                                      g.36196     .           g.36205
                                      c.1986-130  ctccaacacc  c.1986-121

.         .         .         .         .         .           g.36265
ccgttcctgagttaaaagtctatttatttacttccttgttggagaagggcaggagagtac  c.1986-61

.         .         .         .         .         .           g.36325
ctgggaatcattacgatccctagcagctcatcctgccctttgaataccctcactttccag  c.1986-1


Powered by LOVD v.2.0 Build 34
2004-2012 Leiden University Medical Center