Sarcoglycan epsilon (SGCE) - coding DNA reference sequence

(used for mutation description)

(last modified January 23, 2010)


This file was created to facilitate the description of sequence variants in the SGCE gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008893.1, covering SGCE transcript 1 (NM_003919.2). Transcript variant 2 has been described by McNally et al. (see epsilon-sargoglycan), adding an additional exon 09b (NM_001099401.1) encoding 25 extra amino acids. Transcript variant 3 (NM_001099400.1) lacks exon 8 but contains an alternatively spliced exon 10b encoding 11 amino acids and through a frame shift an entirely different C-terminal end.
NOTE:
amino acid numbering of McNally et al. starts with 1 at Met-25.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
           .         .         .         .         .                g.5051
          cgggattaccgagggggtgcgggatgctgatgctgaactggccaagctggg       c.-61

 .         .         .         .         .         .                g.5111
 agggaagaagaaagggaggggaggggagaatcgaggacggacggcctagccaggccaaga       c.-1

          .         .         .         .         .         .       g.5171
 ATGCAATTGCCCCGGTGGTGGGAGCTGGGAGACCCCTGTGCTTGGACGGGACAGGGTCGG       c.60
 M  Q  L  P  R  W  W  E  L  G  D  P  C  A  W  T  G  Q  G  R         p.20

          .         .         .         .          | 02        .    g.31379
 GGGACACGCAGGATGAGCCCCGCGACCACTGGCACATTCTTGCTGACAG | TGTACAGTATT    c.120
 G  T  R  R  M  S  P  A  T  T  G  T  F  L  L  T  V |   Y  S  I      p.40
             ^ start amino acid numbering in McNally et al.

          .         .         .         .         .         .       g.31439
 TTCTCCAAGGTACACTCCGATCGGAATGTATACCCATCAGCAGGTGTCCTCTTTGTTCAT       c.180
 F  S  K  V  H  S  D  R  N  V  Y  P  S  A  G  V  L  F  V  H         p.60

          .         .         .         .         .   | 03     .    g.32858
 GTTTTGGAAAGAGAATATTTTAAGGGGGAATTTCCACCTTACCCAAAACCTG | GCGAGATT    c.240
 V  L  E  R  E  Y  F  K  G  E  F  P  P  Y  P  K  P  G |   E  I      p.80

          .         .         .         .         .         .       g.32918
 AGTAATGATCCCATAACATTTAATACAAATTTAATGGGTTACCCAGACCGACCTGGATGG       c.300
 S  N  D  P  I  T  F  N  T  N  L  M  G  Y  P  D  R  P  G  W         p.100

          .         .         .         .         .         .       g.32978
 CTTCGATATATCCAAAGGACACCATATAGTGATGGAGTCCTATATGGGTCCCCAACAGCT       c.360
 L  R  Y  I  Q  R  T  P  Y  S  D  G  V  L  Y  G  S  P  T  A         p.120

          .         .         . | 04       .         .         .    g.37842
 GAAAATGTGGGGAAGCCAACAATCATTGAG | ATAACTGCCTACAACAGGCGCACCTTTGAG    c.420
 E  N  V  G  K  P  T  I  I  E   | I  T  A  Y  N  R  R  T  F  E      p.140

          .         .         .         .    | 05    .         .    g.42270
 ACTGCAAGGCATAATTTGATAATTAATATAATGTCTGCAGAAG | ACTTCCCGTTGCCATAT    c.480
 T  A  R  H  N  L  I  I  N  I  M  S  A  E  D |   F  P  L  P  Y      p.160

          .         .         .         .         .         .       g.42330
 CAAGCAGAATTCTTCATTAAGAATATGAATGTAGAAGAAATGTTGGCCAGTGAGGTTCTT       c.540
 Q  A  E  F  F  I  K  N  M  N  V  E  E  M  L  A  S  E  V  L         p.180

          .         .         .         .         .         .       g.42390
 GGAGACTTTCTTGGCGCAGTGAAAAATGTGTGGCAGCCAGAGCGCCTGAACGCCATAAAC       c.600
 G  D  F  L  G  A  V  K  N  V  W  Q  P  E  R  L  N  A  I  N         p.200

          .         .         .         .         .         .       g.42450
 ATCACATCGGCCCTAGACAGGGGTGGCAGGGTGCCACTTCCCATTAATGACCTGAAGGAG       c.660
 I  T  S  A  L  D  R  G  G  R  V  P  L  P  I  N  D  L  K  E         p.220

    | 06     .         .         .         .         .         .    g.57815
 GG | CGTTTATGTCATGGTTGGTGCAGATGTCCCGTTTTCTTCTTGTTTACGAGAAGTTGAA    c.720
 G  |  V  Y  V  M  V  G  A  D  V  P  F  S  S  C  L  R  E  V  E      p.240

          .         .         .         .         .         .       g.57875
 AATCCACAGAATCAATTGAGATGTAGTCAAGAAATGGAGCCTGTAATAACATGTGATAAA       c.780
 N  P  Q  N  Q  L  R  C  S  Q  E  M  E  P  V  I  T  C  D  K         p.260

          .         .         .         .      | 07  .         .    g.60367
 AAATTTCGTACTCAATTTTACATTGACTGGTGCAAAATTTCATTG | GTTGATAAAACAAAG    c.840
 K  F  R  T  Q  F  Y  I  D  W  C  K  I  S  L   | V  D  K  T  K      p.280

          .         .         .         .         .         .       g.60427
 CAAGTGTCCACCTATCAGGAAGTGATTCGTGGAGAGGGGATTTTACCTGATGGTGGAGAA       c.900
 Q  V  S  T  Y  Q  E  V  I  R  G  E  G  I  L  P  D  G  G  E         p.300

          .         .         .         .         .         .       g.60487
 TACAAACCCCCTTCTGATTCTTTGAAAAGCAGAGACTATTACACGGATTTCCTAATTACA       c.960
 Y  K  P  P  S  D  S  L  K  S  R  D  Y  Y  T  D  F  L  I  T         p.320

          .         .         .         .         .         .       g.60547
 CTGGCTGTGCCCTCGGCAGTGGCACTGGTCCTTTTTCTAATACTTGCTTATATCATGTGC       c.1020
 L  A  V  P  S  A  V  A  L  V  L  F  L  I  L  A  Y  I  M  C         p.340

          .        | 08.         .         .     | 09   .         . g.61340
 TGCCGACGGGAAGGCGT | GGAAAAGAGAAACATGCAAACACCAGA | CATCCAACTGGTCCAT c.1080
 C  R  R  E  G  V  |  E  K  R  N  M  Q  T  P  D  |  I  Q  L  V  H   p.360

          .         .         .         .         .         .       g.61400
 CACAGTGCTATTCAGAAATCTACCAAGGAGCTTCGAGACATGTCCAAGAATAGAGAGATA       c.1140
 H  S  A  I  Q  K  S  T  K  E  L  R  D  M  S  K  N  R  E  I         p.380

          .         .         .         .         .         .       g.61460
 GCATGGCCCCTGTCAACGCTTCCTGTGTTCCACCCTGTGACTGGGGAAATCATACCTCCT       c.1200
 A  W  P  L  S  T  L  P  V  F  H  P  V  T  G  E  I  I  P  P         p.400

          .         .         .         .         .    | 10    .    g.71562
 TTACACACAGACAACTATGATAGCACAAACATGCCATTGATGCAAACGCAGCA | GAACTTG    c.1260
 L  H  T  D  N  Y  D  S  T  N  M  P  L  M  Q  T  Q  Q  |  N  L      p.420
                       alternatively spliced exon 09b  ^

          .         .         .        | 11.         .              g.74795
 CCACATCAGACTCAGATTCCCCAACAGCAGACTACAG | GTAAATGGTATCCCTGA          c.1314
 P  H  Q  T  Q  I  P  Q  Q  Q  T  T  G |   K  W  Y  P  X            p.437
                                         V  N  G  I  P  E           p.
       alternatively spliced exon 10b  ^

          .         .         .         .         .         .       g.74855
 agaaagaaaactgactgaagcaatgaatttataatcagacaatatagcagttacatcaca       c.*60
  E  R  K  L  T  E  A  M  N  L  *                                   p.

          .         .         .         .         .         .       g.74915
 tttcttttctcttccaataatgcatgagcttttctggcatatgttatgcatgttggcagt       c.*120

          .         .         .         .         .         .       g.74975
 attaagtgtataccaaataatacaacataactttcattttactaatgtatttttttgtac       c.*180

          .         .         .         .         .         .       g.75035
 ttaaagcatttttgacaatttgtaaaacattgatgactttatatttgttacaataaaagt       c.*240

          .         .         .                                     g.75070
 tgatctttaaaataaatattattaatgaagcctaa                                c.*275

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan epsilon protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center