Sarcoglycan epsilon (SGCE) - 10042 nt intron 09 reference sequence

Contains alternatively spliced exon 09b.

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.62495
gtaagtgtccacttagagccataattattaatatgcatgtatatttttactaatatctgt  c.1253+60

         .         .         .         .         .         .  g.62555
aaagaacagagctttctgttgttgtgtttgtttgtttataactggaagagaaaataacaa  c.1253+120

         .         .         .         .         .         .  g.62615
aaggacattgtgtaaatctcacccctactctcctgaaatatacaatacaattacttttag  c.1253+180

         .         .         .         .         .         .  g.62675
gaaatgcactttttttcccccactgatccaaacaagactacatataccttaatatttaag  c.1253+240

         .         .         .         .         .         .  g.62735
aaattgacactgatattaaactcaacattacatgtttgctcaaagatgagttaattataa  c.1253+300

         .         .         .         .         .         .  g.62795
aaaaaagaaccatatcctaagcatttcaaattgattatttttagagatattagaattatt  c.1253+360

         .         .         .         .         .         .  g.62855
tggtttaaacctattaaaatgttattaccatagacctttgtaatctaaatttttgcctca  c.1253+420

         .         .         .         .         .         .  g.62915
gaattaagggtgtttgggttgttttttatgatctgcttgtatgtcagagcaagcagctcc  c.1253+480

         .         .         .         .         .         .  g.62975
aatttggactataaacacctattttattagtgcaaaccttgtctagtgctatagggatca  c.1253+540

         .         .         .         .         .         .  g.63035
gggttagaaaggctagaaggactttgtaaggagtagacaagggtgaggggtgaggaaact  c.1253+600

         .         .         .         .         .         .  g.63095
gtacagttgcatttgggagaccatgctatataatgctgtaatgcagcattatgctacatc  c.1253+660

         .         .         .         .         .         .  g.63155
atatattgctgatataatgtagcctagtggccacatttttatataagggaatggtgggta  c.1253+720

         .         .         .         .         . | 09b      .  g.63215
aaactgttatttataagaatatgtctctttttttcttttttttttttaag | atggagtttc  c.1253+780
                                                   |  W  S  F    p.418+3
                    alternatively spliced exon 9b  ^
         .         .         .         .         .         .  g.63275
gctcctgttgcccaggctggagtgcaatggagcgatcttggctcactgcagcctccgcct  c.1253+840
A  P  V  A  Q  A  G  V  Q  W  S  D  L  G  S  L  Q  P  P  P    p.418+23

      |     .         .         .         .         .         .  g.63335
cccag | gttcaagtgattctcctgcctcagcctcccaagtagctcggattatacgcacctg  c.1253+900
P  R  |                                                          p.418+25

         .         .         .         .         .         .  g.63395
cccccatgcccagctaatttttgtatttttagtagggatggggtttcaccatgttggcca  c.1253+960

         .         .         .         .         .         .  g.63455
ggctggtcttgaaatcctggcctaggtgatctgcctgcctcagcctccaaagtactggga  c.1253+1020

         .         .         .         .         .         .  g.63515
ttacaggtgtgagccaccatgcccggccttttttctttttaaccaaatgttaaaatgagt  c.1253+1080

         .         .         .         .         .         .  g.63575
tgaattcaattgccctaagcactagaagtcatgaagttggcttttgaggtcctcctcttt  c.1253+1140

         .         .         .         .         .         .  g.63635
ttcactttacttttatagatggaatggctatgcagaaaaatctctctttctcactctctc  c.1253+1200

         .         .         .         .         .         .  g.63695
agtctctctttctctctctctcatacacacagacacatacacaccccttaggatataata  c.1253+1260

         .         .         .         .         .         .  g.63755
ttaaagtgaacacatttacctgggaactctgctgggtacatttttcccattgagtgctta  c.1253+1320

         .         .         .         .         .         .  g.63815
ttctgtaaccaggtagaatgcatgtggtaatttgaagattaaataataattaatataagt  c.1253+1380

         .         .         .         .         .         .  g.63875
agtatagatagactagataagtttatccagaatacttcagaaacccaaaagtattatgaa  c.1253+1440

         .         .         .         .         .         .  g.63935
tatttttctaaagttctctaacatcacttagggtcatacagactaaggtgcctgtttatg  c.1253+1500

         .         .         .         .         .         .  g.63995
tgcatgtgtgtatgagagtgtaagtaatgggtagtgggtaatttaagaaatgggtgaaat  c.1253+1560

         .         .         .         .         .         .  g.64055
tgcatatgtttacaattttgaatttttgaaacattaatatatcagggatataaatattaa  c.1253+1620

         .         .         .         .         .         .  g.64115
agtctacaaaatttagttgtactgaatgcaacggatgggtttctatgctctctggtggtc  c.1253+1680

         .         .         .         .         .         .  g.64175
agtagcccacctattatgggtcatcataaaacccagtttaccgggattagatactgatga  c.1253+1740

         .         .         .         .         .         .  g.64235
gaaaaattggtaaaatttcaagaatattgtaataattcagaatttaacaacctcttatcc  c.1253+1800

         .         .         .         .         .         .  g.64295
ctttttagatgaaaattatgaaatggctttatcattcattttcaaaatgaaaagaatttg  c.1253+1860

         .         .         .         .         .         .  g.64355
tacttattctttaaggttattatttctgatattgtttaccctagcgtgccagtgaaatgt  c.1253+1920

         .         .         .         .         .         .  g.64415
tgacagatatccttcaaaaaaatggaatgatcaaatacacttggaaaaaagtagtagcaa  c.1253+1980

         .         .         .         .         .         .  g.64475
cactgcagaattctaacatgaaacaaatcctgtagctaaccaaattgtttatgaatgatg  c.1253+2040

         .         .         .         .         .         .  g.64535
aattcagtatacttagtatgaatgtgaagatgaaatgcatgcccttttaagaagggttaa  c.1253+2100

         .         .         .         .         .         .  g.64595
ttaataagtacaaggcagcattatccaagcatatacctggttatcgagtactgtaacgta  c.1253+2160

         .         .         .         .         .         .  g.64655
aaggttttatttctctgttttttaagctacaacagtcttcagtcccttagtgtgttgata  c.1253+2220

         .         .         .         .         .         .  g.64715
cactttgtgaatccataggaaaaggtcagaataggtaactcttcaaagaacacagtttga  c.1253+2280

         .         .         .         .         .         .  g.64775
gaaatgcttctgttgataatgtaacaaacagtgctgtagaattttagagtagaaaactag  c.1253+2340

         .         .         .         .         .         .  g.64835
ttataatgagtaggggaacttgaatatgtttgtaaatcaataaaactctattgctagtga  c.1253+2400

         .         .         .         .         .         .  g.64895
aatttaagagcggaaaaaggttgctgtcattttaagataaccctttctaaccacatatat  c.1253+2460

         .         .         .         .         .         .  g.64955
tgaaaataagaatagctccttaaaaagtattttgattccctgtggttagaattttgcaat  c.1253+2520

         .         .         .         .         .         .  g.65015
gttgctactaatatacaagcaaaataaaattttctatctagtttacaccaaatggatctt  c.1253+2580

         .         .         .         .         .         .  g.65075
tctggtccttccataaccccatcaagactgtcattaggttgatcagatctctctatttgc  c.1253+2640

         .         .         .         .         .         .  g.65135
aaatgcaataggctattatattgaacttgcaacaatttaaacacatacgtatttttaagt  c.1253+2700

         .         .         .         .         .         .  g.65195
ccagaaaaccttcacattattcagatttctgctaatggaaaagctccattaactagcact  c.1253+2760

         .         .         .         .         .         .  g.65255
tctatataaatagggtacacagataattgatgatgttcacaatgattattctgaggcact  c.1253+2820

         .         .         .         .         .         .  g.65315
gcaggatcatcaagtgcgtctgactcatcagaggaaaattaaattacattcggtgtcgtt  c.1253+2880

         .         .         .         .         .         .  g.65375
tcagtgttgagtgtatattatctttcttttattcttagaaatggataatatgtgcacagt  c.1253+2940

         .         .         .         .         .         .  g.65435
ctctatggtaactccctataagccagaatatgtgattaacctcattttccagccatgcca  c.1253+3000

         .         .         .         .         .         .  g.65495
gataatagggaatttattgtatggggttcatcatagctgtcctttatgcaaattcaactt  c.1253+3060

         .         .         .         .         .         .  g.65555
ttactttttaccagaaaaacagctatgttttaaaagttttacttcagcactgagtagaca  c.1253+3120

         .         .         .         .         .         .  g.65615
cacacaaatattttggtcatttggattgaattgaattctcaagattaaaatgtgatatta  c.1253+3180

         .         .         .         .         .         .  g.65675
tattttgggaggcattacagtactcaataaccaggtatatgcttggataatgctgtcttg  c.1253+3240

         .         .         .         .         .         .  g.65735
tacttattaatttacccttcctataagggcatgcatttcatcttcacattcatactaagt  c.1253+3300

         .         .         .         .         .         .  g.65795
gtactgaatttatcattcataaacaatttttagctagccaaaggatttcatgtttattct  c.1253+3360

         .         .         .         .         .         .  g.65855
tcagattgataccggaaatattcagacatggatatggctaaaggtttatattggcttcta  c.1253+3420

         .         .         .         .         .         .  g.65915
agcaagactcaagaatattcaaagctttctttcaaaactgcataaaactagtttgttcct  c.1253+3480

         .         .         .         .         .         .  g.65975
ttaaacaagtcaatttacatcaaagttatagagaactcacaatgttatgtaatgaatggc  c.1253+3540

         .         .         .         .         .         .  g.66035
tgccaccattatcaattacatagtaatattttctttttggtagaatgtttcacagagctc  c.1253+3600

         .         .         .         .         .         .  g.66095
cagactggcaccataaattagtcagtaagaaaaaatgtttaatcatttgcagatgataaa  c.1253+3660

         .         .         .         .         .         .  g.66155
tttgagacactgataagagacaaagttaaattaggtcagaactgagattagattatttac  c.1253+3720

         .         .         .         .         .         .  g.66215
ctatcctgatatctaggcagggatagatagtgtcggtcattgacctcagaaggatctctg  c.1253+3780

         .         .         .         .         .         .  g.66275
attcaggttataagcaaaatgaataaagaggcagtggacagggaagctggagcagaacct  c.1253+3840

         .         .         .         .         .         .  g.66335
ggagatgtagcacatgcctagaaatgaggtgtttcattttgtactgtgtttcttttgctt  c.1253+3900

         .         .         .         .         .         .  g.66395
ttcaaattacagagacaatataaataggctgttaaaactatcacatagtctagaaatgta  c.1253+3960

         .         .         .         .         .         .  g.66455
aggccaacttaatttgatcttggctaatgtgtttattctttaataaactttttattttgg  c.1253+4020

         .         .         .         .         .         .  g.66515
aatgattgtagaggtacaggaaagttacaaagataatagagagttcccagatacgcctca  c.1253+4080

         .         .         .         .         .         .  g.66575
gccagtttctcccgttgttaacatcttacagtaccatggtacatttgtcacaatgaggaa  c.1253+4140

         .         .         .         .         .         .  g.66635
cccagtttcggtactttactgttacctagacttcagacttttttcagatgtcattcgttt  c.1253+4200

         .         .         .         .         .         .  g.66695
ttccactaatgtcctttttctgttctaggattccatctaggacacaataatcactatgtc  c.1253+4260

         .         .         .         .         .         .  g.66755
tccttagtctcctcaggtctgggcattttcttagacctttcttgtgtcccatgacctcga  c.1253+4320

         .         .         .         .         .         .  g.66815
cagtcatgaggagctatagccaggtattgtgtagtatgtccctcatgccctcatatagta  c.1253+4380

         .         .         .         .         .         .  g.66875
agtttttctgcatctgtacttagttatctttgtagcctagtgaataagtgttgccattaa  c.1253+4440

         .         .         .         .         .         .  g.66935
tagcagtaataattttttcccctatagacatttgtcttagttattaaaattcattcctgg  c.1253+4500

         .         .         .         .         .         .  g.66995
aaatcacattgtaaagtaattcttaaaagtaaattgactttgcccaaagaatcattgttg  c.1253+4560

         .         .         .         .         .         .  g.67055
tgactggtgttatgtttgtgaccaaagacttcacatcaaaaatctattacgtatttgacc  c.1253+4620

         .         .         .         .         .         .  g.67115
ggtgtacctcaatgattgccctttctaattatttaaatgaaaaaaatttaattccaagta  c.1253+4680

         .         .         .         .         .         .  g.67175
ataacattttaggtcatcaaaggaacgtcaagagagagtctagccttgttcccaaaccac  c.1253+4740

         .         .         .         .         .         .  g.67235
gttgtgtcagaatcaccatagagcttttacagtacacattctggggctctgagtatggga  c.1253+4800

         .         .         .         .         .         .  g.67295
atttggagtctggtggaagtgtatgttatggtagagctcctgcagagagcttctcaacaa  c.1253+4860

         .         .         .         .         .         .  g.67355
agattgagaattcctggcttaataatcaaaagacttaagtttcaggattggaaaatccag  c.1253+4920

         .         .         .         .         .         .  g.67415
agctctgagtaagaagggttgttattcacattcctctacatggagttttaaaaggggaac  c.1253+4980

         .         .         .         .   g.67456
agtttttcctaaattcccccatgtgaaactgaaagaatagc  c.1253+5021

--------------------- middle of intron ---------------------
      g.67457       .         .         .         .           g.67497
      c.1254-5021  agtccatgcacattgtctaggaggttggagctgtttgggag  c.1254-4981

.         .         .         .         .         .           g.67557
tttatacttctcagcctctagactcttccatacctccttaaactgcctgaggaaaatggt  c.1254-4921

.         .         .         .         .         .           g.67617
gtggagaggttgagagatgagagctaatcagaaaacagtgcctggaacagctaaaagcca  c.1254-4861

.         .         .         .         .         .           g.67677
ttgaaaaaatgttattttgtagtcttatgcttggggaaagggacattgactggaggatcc  c.1254-4801

.         .         .         .         .         .           g.67737
caaatatttgattttctaaaaaataatttattattatattaaatttgtagtgaggtatgc  c.1254-4741

.         .         .         .         .         .           g.67797
tgtcttttggggaaagatctgcctcttcactactcttttcttatgccaacatcaatacca  c.1254-4681

.         .         .         .         .         .           g.67857
attgatttttttggagtggtaggcatcttcatgaggccccttaggtaatgaataattggg  c.1254-4621

.         .         .         .         .         .           g.67917
gaatagtactccacacatttttcaggaagatattaatttgctacacaaaaattttcctta  c.1254-4561

.         .         .         .         .         .           g.67977
ttcattattctaaacataattcctaatccaggataattgggtctctctcaaaacaggaga  c.1254-4501

.         .         .         .         .         .           g.68037
taggttgtacttaatcttttgaaaattaacaagtataaaagtagaattaagtcttctaat  c.1254-4441

.         .         .         .         .         .           g.68097
tgaagacagtatctaatcattttagcttttatttaaatatttttccatttgtcctgcttt  c.1254-4381

.         .         .         .         .         .           g.68157
tggtcacaatgacaactaactttatggtaaaattccataaataaaaattaagttttaata  c.1254-4321

.         .         .         .         .         .           g.68217
aaagttaatatcagttgaagacagtgtttcaggggactaagattatggtgtcctgttgag  c.1254-4261

.         .         .         .         .         .           g.68277
aagtatcaggcagccaagaatatttcagagccattgttttccaaaaatatataactattt  c.1254-4201

.         .         .         .         .         .           g.68337
cttattgttaaatgatgtcaccatactaactgaaaagtgaaatgttttgtatttcacaca  c.1254-4141

.         .         .         .         .         .           g.68397
actagtgtcattttctttgaactctggcatggattctgtggctttatgcaaatcatcatt  c.1254-4081

.         .         .         .         .         .           g.68457
ttgctttttagtttgaaacaagtagcaatataatcagttgataatcatcaaccttactca  c.1254-4021

.         .         .         .         .         .           g.68517
cagaattacggtatagggtatccaagaatgtcaaattactttaaaatggttgtacacata  c.1254-3961

.         .         .         .         .         .           g.68577
agaaataattgtgtactccccccaactcacttatttattaatttgcaagttattactctt  c.1254-3901

.         .         .         .         .         .           g.68637
gcattcttaaagaatgaagtttgtgcaatgactaatttacacaattttctatttaaatgc  c.1254-3841

.         .         .         .         .         .           g.68697
atgaaattaatgaacataaaatgagaaaataattaatgctaataatttagttacagtttt  c.1254-3781

.         .         .         .         .         .           g.68757
cttaaatttctacataatgcagtttacacataataacttttcacttagtctaataatcat  c.1254-3721

.         .         .         .         .         .           g.68817
taaattgttttatgacttcattaaggtccctccttggaaggattatagggcctctatttg  c.1254-3661

.         .         .         .         .         .           g.68877
aagtcgaccccccgctcctgtataattgcctttagcagcctgctctcaccaaagatgaga  c.1254-3601

.         .         .         .         .         .           g.68937
atttgccactttcttcctgcattctctgcatcttaactagcagagttgggattgaaggca  c.1254-3541

.         .         .         .         .         .           g.68997
ttttttccagtatgcctgaagcagtgctgttataaagtatgtcccttcaactcttaaatg  c.1254-3481

.         .         .         .         .         .           g.69057
aaatacacagttttaaatatgcccatcatagatacattcacactttaatacttacaggtt  c.1254-3421

.         .         .         .         .         .           g.69117
cacatttagttacaagtttgggaagccacaaaaacagagctatgtgcacacatcttggag  c.1254-3361

.         .         .         .         .         .           g.69177
actcaagggtctccttcaaaacaggagataggttgtacccaatcaggggatgttgaatct  c.1254-3301

.         .         .         .         .         .           g.69237
cagtatttttttggttgagcacctttttgcgcacacaagcatttttaatataactcatct  c.1254-3241

.         .         .         .         .         .           g.69297
aagtttcctttgaaactgcaaggagtgcatgagcattgttcaaacacaaccacttagaac  c.1254-3181

.         .         .         .         .         .           g.69357
acccactatggatacttttcagtctctaaatcaatataagacacacagttgctttcttat  c.1254-3121

.         .         .         .         .         .           g.69417
gcatcttctccgaatttcttgctagtttgtgtgtggcatttttctcaaccagccatgtct  c.1254-3061

.         .         .         .         .         .           g.69477
tttcacctagcccagcccattgtgatttagaaagtttagcaatgtagcaaaagaggaaaa  c.1254-3001

.         .         .         .         .         .           g.69537
aacggaggctagaaaagaaacgacagggcataggttgactttgatcagtggtttccaagc  c.1254-2941

.         .         .         .         .         .           g.69597
taaattccacagaaaggtcagttgggagggccaacaagagaagtggggggcatccaacta  c.1254-2881

.         .         .         .         .         .           g.69657
cctcatccaaatgctgattttgaatttggaggatccttaatctagtgcttttggaaaaca  c.1254-2821

.         .         .         .         .         .           g.69717
tgtgtctttgtttactaaccactacctatgttagaacacctacattctatattttcttta  c.1254-2761

.         .         .         .         .         .           g.69777
tcctgtttgatttttgtattttgtcagaatgtgttgattcaatctgctgacaggctaggt  c.1254-2701

.         .         .         .         .         .           g.69837
agagctagagatggtaaggaatgaggaagtgcttgtgtgtggtgtgcgcctatgtgtaga  c.1254-2641

.         .         .         .         .         .           g.69897
aggtgcactgtgttcgttttgagtgtagaatagacccagatcagttatacctgagtaggt  c.1254-2581

.         .         .         .         .         .           g.69957
aaaataaaacacatcctcccaccctgtgtgagatgcccatctaattgcattttgacttct  c.1254-2521

.         .         .         .         .         .           g.70017
gtagtaaagatatttgccttgccatctttaaatgtagaacttattccctctttgtagttt  c.1254-2461

.         .         .         .         .         .           g.70077
ataaattgatctttttacttttgtgaccaaaaccaatataaatacattgtgtgaaattct  c.1254-2401

.         .         .         .         .         .           g.70137
gaaagaacaaacaagctaaaaaagaaatactcctctagcctacacaaggataaggctgat  c.1254-2341

.         .         .         .         .         .           g.70197
aagtaacaataaaaacgaatataatcgtcgggatgaattattaagtaacttcctcaaatt  c.1254-2281

.         .         .         .         .         .           g.70257
gtgttagagttgagtttattatttccctagtaatatctttaaagtggaactgaaacatta  c.1254-2221

.         .         .         .         .         .           g.70317
aaaaaaactctcaaaggtgttacctatagattaagagtttaaacagcatttaactagcac  c.1254-2161

.         .         .         .         .         .           g.70377
gcactgttttccactttagattgttgtatttggaacataatatttgcctggctgaaataa  c.1254-2101

.         .         .         .         .         .           g.70437
ttcatatcaatggttttcaaactgttttttacagatttcttagaattgctgtaggggcca  c.1254-2041

.         .         .         .         .         .           g.70497
gcatgagggacaaagaaaacaaagctgacaggattcctaactcccttgtttcaacccagg  c.1254-1981

.         .         .         .         .         .           g.70557
caacctcacatttatctcttttgtacatcacagttctgcttagggtttcaattaagagga  c.1254-1921

.         .         .         .         .         .           g.70617
atcccagtgctaaagagaaaacaaaaaactgaaaatccccagcttggatcaaactttatt  c.1254-1861

.         .         .         .         .         .           g.70677
acaaaggactgactcctggagtttcttccatacagaacctaaattgtacattttcataaa  c.1254-1801

.         .         .         .         .         .           g.70737
ctaattttagtatcaatatgtgaaactaaatctgtaagttaataaatgtatatactttat  c.1254-1741

.         .         .         .         .         .           g.70797
aatgcttactgctgaggatactaaacaaaatatgatggttcttattcttaatatactttg  c.1254-1681

.         .         .         .         .         .           g.70857
gggcaattaaatattatatacagagaatacaatgacaatcagcatgtgaatgaaagcatg  c.1254-1621

.         .         .         .         .         .           g.70917
ctaaatggtaacctaatttgtgggttgcttagagagtgaggatgcataggaaggtggttc  c.1254-1561

.         .         .         .         .         .           g.70977
ttgagatttttttaattaaaaataatatgttaaaaattttaataacatttctcatgggaa  c.1254-1501

.         .         .         .         .         .           g.71037
tttttaaactataagagtaatacctgtatgctgtaacaagttctgagttgagttagcaag  c.1254-1441

.         .         .         .         .         .           g.71097
aacaaatgggagctgattgtgtacaggacatggtagttggttgttggcttcaagcagaca  c.1254-1381

.         .         .         .         .         .           g.71157
tggggcactccatgtaggagtgagatatattgtggctttccaggccacattaagaaatct  c.1254-1321

.         .         .         .         .         .           g.71217
gaaatttaatctgcagatagatacaaggaaatattgaaatgtgtgttatttaaatgacat  c.1254-1261

.         .         .         .         .         .           g.71277
aatcagatttgtgtcttagaacagtggtccccaagctttttggcaccaggaactggtttc  c.1254-1201

.         .         .         .         .         .           g.71337
atgtcagaccaggagtgggggatggtttggggtggtccaagtgcattgcatttattatgc  c.1254-1141

.         .         .         .         .         .           g.71397
actttatttctattattacattgtaatatataatgaaatattatataactcaccataatg  c.1254-1081

.         .         .         .         .         .           g.71457
tagaatcagtgggagccctcagcttgttttcctgcaactagacagtaccatcagggggtg  c.1254-1021

.         .         .         .         .         .           g.71517
atgggggacagtgacagatcatcaggcattagattctcataaggagtgcacaacctagat  c.1254-961

.         .         .         .         .         .           g.71577
ccctcgcatacgcagttcacagtagggttcatgctcctatgaccgtctactgctgccgct  c.1254-901

.         .         .         .         .         .           g.71637
ggtctgacaggaggcagaacccaggtggtaatgcaagtgatggggagcacctgtaaatac  c.1254-841

.         .         .         .         .         .           g.71697
agatgaggcttcgatggcttacctgccactcacctcctgctgggcagcccagttccgtgt  c.1254-781

.         .         .         .         .         .           g.71757
cccaggggttggggacccctgtcttagaagattattctgacagcaatgtgcagagtggat  c.1254-721

.         .         .         .         .         .           g.71817
tataaggggacaagaatgtaaatgaggaaacaagtcaatccccttacaaggatccaagtg  c.1254-661

.         .         .         .         .         .           g.71877
agaaatgatgatggcttcaaccaagttagcaatggagatggggaggaatggggcagatcc  c.1254-601

.         .         .         .         .         .           g.71937
aaatgagacaaaaagaaatgtcaaaagtccctaagtgattgaatgtggggactgaaggag  c.1254-541

.         .         .         .         .         .           g.71997
agggaaggaacaaggatgacttctgcattccgccaatgcatctggatgcatggccagtgt  c.1254-481

.         .         .         .         .         .           g.72057
cattcctgacacgaagataaaagagcacagatgtttgggatagtgaatgaaggtggttat  c.1254-421

.         .         .         .         .         .           g.72117
atatgttgttccatgaaaatgtgtgatctggatctgaaagtgtataggttaagagcacaa  c.1254-361

.         .         .         .         .         .           g.72177
gccactgtgttcacatctttacctaccatgtcctagctatgtggccctggatctccaagg  c.1254-301

.         .         .         .         .         .           g.72237
ctatttcttcacccataaaatgggaaaaatattaacacctacctcttagggttgttgtga  c.1254-241

.         .         .         .         .         .           g.72297
ggtactttagagtatagcccgcagtgaaaatttcatgcatgttatcaaatattgttaatt  c.1254-181

.         .         .         .         .         .           g.72357
tttattctcctcagacctcagtttcctcatctgtaagctcatgaaaggggaggggaattg  c.1254-121

.         .         .         .         .         .           g.72417
tgctggattacatgactggggtcatagtttacccgtaaagtttttcattctagtatgtct  c.1254-61

.         .         .         .         .         .           g.72477
gctctctgtttacaagtgtgtaaacaaacagttttactcaaaaatgttcatcatttctag  c.1254-1


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center