Laminin-alpha 2 (merosin) (LAMA2) - coding DNA reference sequence

(used for mutation description)

(last modified July 19, 2009)


This file was created to facilitate the description of sequence variants in the LAMA2 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008678.1, covering transcript variant 1 (NM_000426.3). Exon 53 is alternatively spliced (NM_001079823.1) and Pegoraro (2000) described a transcript missing most of exon 32 (~10% of the transcripts).

NOTE: exon numbering differs from that originally reported by Zhang et al. (1996); their exon 5 sequence actually covers 2 exons. The total numer of LAMA2-exons is thus 65 (not 64).

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.5045
                ttccccagcagctgctgctcgctcagctcacaagccaaggccagg       c.-61

 .         .         .         .         .         .                g.5105
 ggacagggcggcagcgactcctctggctcccgagaagtggatccggtcgcggccactacg       c.-1

          .         .         .         .         .         .       g.5165
 ATGCCGGGAGCCGCCGGGGTCCTCCTCCTTCTGCTGCTCTCCGGAGGCCTCGGGGGCGTA       c.60
 M  P  G  A  A  G  V  L  L  L  L  L  L  S  G  G  L  G  G  V         p.20

          .         .         .         .         .   | 02     .    g.171785
 CAGGCGCAGCGGCCGCAGCAGCAGCGGCAGTCACAGGCACATCAGCAAAGAG | GTTTATTC    c.120
 Q  A  Q  R  P  Q  Q  Q  R  Q  S  Q  A  H  Q  Q  R  G |   L  F      p.40

          .         .         .         .         .         .       g.171845
 CCTGCTGTCCTGAATCTTGCTTCTAATGCTCTTATCACGACCAATGCAACATGTGGAGAA       c.180
 P  A  V  L  N  L  A  S  N  A  L  I  T  T  N  A  T  C  G  E         p.60

          .         .         .         .         .         .       g.171905
 AAAGGACCTGAAATGTACTGCAAATTGGTAGAACATGTCCCTGGGCAGCCTGTGAGGAAC       c.240
 K  G  P  E  M  Y  C  K  L  V  E  H  V  P  G  Q  P  V  R  N         p.80

          .         .         .         .    | 03    .         .    g.181660
 CCGCAGTGTCGAATCTGCAATCAAAACAGCAGCAATCCAAACC | AGAGACACCCGATTACA    c.300
 P  Q  C  R  I  C  N  Q  N  S  S  N  P  N  Q |   R  H  P  I  T      p.100

          .         .         .         .         .         .       g.181720
 AATGCTATTGATGGAAAGAACACTTGGTGGCAGAGTCCCAGTATTAAGAATGGAATCGAA       c.360
 N  A  I  D  G  K  N  T  W  W  Q  S  P  S  I  K  N  G  I  E         p.120

          .         .         .       | 04 .         .         .    g.220056
 TACCATTATGTGACAATTACCCTGGATTTACAGCAG | GTGTTCCAGATCGCGTATGTGATT    c.420
 Y  H  Y  V  T  I  T  L  D  L  Q  Q   | V  F  Q  I  A  Y  V  I      p.140

          .         .         .         .         .         .       g.220116
 GTGAAGGCAGCTAACTCCCCCCGGCCTGGAAACTGGATTTTGGAACGCTCTCTTGATGAT       c.480
 V  K  A  A  N  S  P  R  P  G  N  W  I  L  E  R  S  L  D  D         p.160

          .         .         .         .         .         .       g.220176
 GTTGAATACAAGCCCTGGCAGTATCATGCTGTGACAGACACGGAGTGCCTAACGCTTTAC       c.540
 V  E  Y  K  P  W  Q  Y  H  A  V  T  D  T  E  C  L  T  L  Y         p.180

          .         .         .         .         .         .       g.220236
 AATATTTATCCCCGCACTGGGCCACCGTCATATGCCAAAGATGATGAGGTCATCTGCACT       c.600
 N  I  Y  P  R  T  G  P  P  S  Y  A  K  D  D  E  V  I  C  T         p.200

          .         .         .          | 05        .         .    g.265781
 TCATTTTACTCCAAGATACACCCCTTAGAAAATGGAGAG | ATTCACATCTCTTTAATCAAT    c.660
 S  F  Y  S  K  I  H  P  L  E  N  G  E   | I  H  I  S  L  I  N      p.220

          .         .         .         .         .         .       g.265841
 GGGAGACCAAGTGCCGATGATCCTTCTCCAGAACTGCTAGAATTTACCTCCGCTCGCTAT       c.720
 G  R  P  S  A  D  D  P  S  P  E  L  L  E  F  T  S  A  R  Y         p.240

          .         .         .         .         .         .       g.265901
 ATTCGCCTGAGATTTCAGAGGATCCGCACACTGAATGCTGACTTGATGATGTTTGCTCAC       c.780
 I  R  L  R  F  Q  R  I  R  T  L  N  A  D  L  M  M  F  A  H         p.260

          .         .         .          | 06        .         .    g.268839
 AAAGACCCAAGAGAAATTGACCCCATTGTCACCAGAAGA | TATTACTACTCGGTCAAGGAT    c.840
 K  D  P  R  E  I  D  P  I  V  T  R  R   | Y  Y  Y  S  V  K  D      p.280

          .         .         .         .         .         .       g.268899
 ATTTCAGTTGGAGGGATGTGCATCTGCTATGGTCATGCCAGGGCTTGTCCACTTGATCCA       c.900
 I  S  V  G  G  M  C  I  C  Y  G  H  A  R  A  C  P  L  D  P         p.300

           | 07        .         .         .         .         .    g.270889
 GCGACAAAT | AAATCTCGCTGTGAGTGTGAGCATAACACATGTGGCGATAGCTGTGATCAG    c.960
 A  T  N   | K  S  R  C  E  C  E  H  N  T  C  G  D  S  C  D  Q      p.320

          .         .         .         .         .         .       g.270949
 TGCTGTCCAGGATTCCATCAGAAACCCTGGAGAGCTGGAACTTTTCTAACTAAAACTGAA       c.1020
 C  C  P  G  F  H  Q  K  P  W  R  A  G  T  F  L  T  K  T  E         p.340

         | 08.         .         .         .         .         .    g.276417
 TGTGAAG | CATGCAATTGTCATGGAAAAGCTGAAGAATGCTATTATGATGAAAATGTTGCC    c.1080
 C  E  A |   C  N  C  H  G  K  A  E  E  C  Y  Y  D  E  N  V  A      p.360

          .         .         .         .         .         .       g.276477
 AGAAGAAATCTGAGTTTGAATATACGTGGAAAGTACATTGGAGGGGGTGTCTGCATTAAT       c.1140
 R  R  N  L  S  L  N  I  R  G  K  Y  I  G  G  G  V  C  I  N         p.380

          .         .         .         .         .         .       g.276537
 TGTACCCAAAACACTGCTGGTATAAACTGCGAGACATGTACTGATGGCTTCTTCAGACCC       c.1200
 C  T  Q  N  T  A  G  I  N  C  E  T  C  T  D  G  F  F  R  P         p.400

        | 09 .         .         .         .         .         .    g.287489
 AAAGGG | GTATCTCCAAATTATCCAAGGCCATGCCAGCCATGTCATTGCGATCCAATTGGT    c.1260
 K  G   | V  S  P  N  Y  P  R  P  C  Q  P  C  H  C  D  P  I  G      p.420

          .         .         .         .       | 10 .         .    g.299579
 TCCTTAAATGAAGTCTGTGTCAAGGATGAGAAACATGCTCGACGAG | GTTTGGCACCTGGA    c.1320
 S  L  N  E  V  C  V  K  D  E  K  H  A  R  R  G |   L  A  P  G      p.440

          .         .         .         .         .         .       g.299639
 TCCTGTCATTGCAAAACTGGTTTTGGAGGTGTGAGCTGTGATCGGTGTGCCAGGGGCTAC       c.1380
 S  C  H  C  K  T  G  F  G  G  V  S  C  D  R  C  A  R  G  Y         p.460

          .         .         .         .         .         .       g.299699
 ACTGGCTACCCGGACTGCAAAGCCTGTAACTGCAGTGGGTTAGGGAGCAAAAATGAGGAT       c.1440
 T  G  Y  P  D  C  K  A  C  N  C  S  G  L  G  S  K  N  E  D         p.480

          .         .        | 11.         .         .         .    g.312097
 CCTTGTTTTGGCCCCTGTATCTGCAAG | GAAAATGTTGAAGGAGGAGACTGTAGTCGTTGC    c.1500
 P  C  F  G  P  C  I  C  K   | E  N  V  E  G  G  D  C  S  R  C      p.500

          .         .         .         .         .         .       g.312157
 AAATCCGGCTTCTTCAATTTGCAAGAGGATAATTGGAAAGGCTGCGATGAGTGTTTCTGT       c.1560
 K  S  G  F  F  N  L  Q  E  D  N  W  K  G  C  D  E  C  F  C         p.520

          .         .         .         .         | 12         .    g.314551
 TCAGGGGTTTCAAACAGATGTCAGAGTTCCTACTGGACCTATGGCAAA | ATACAAGATATG    c.1620
 S  G  V  S  N  R  C  Q  S  S  Y  W  T  Y  G  K   | I  Q  D  M      p.540

          .         .         .         .         .         .       g.314611
 AGTGGCTGGTATCTGACTGACCTTCCTGGCCGCATTCGAGTGGCTCCCCAGCAGGACGAC       c.1680
 S  G  W  Y  L  T  D  L  P  G  R  I  R  V  A  P  Q  Q  D  D         p.560

          .         .         .         .         .         .       g.314671
 TTGGACTCACCTCAGCAGATCAGCATCAGTAACGCGGAGGCCCGGCAAGCCCTGCCGCAC       c.1740
 L  D  S  P  Q  Q  I  S  I  S  N  A  E  A  R  Q  A  L  P  H         p.580

          .         .         .         .   | 13     .         .    g.371989
 AGCTACTACTGGAGCGCGCCGGCTCCCTATCTGGGAAACAAA | CTCCCAGCAGTAGGAGGA    c.1800
 S  Y  Y  W  S  A  P  A  P  Y  L  G  N  K   | L  P  A  V  G  G      p.600

          .         .         .         .         .         .       g.372049
 CAGTTGACATTTACCATATCATATGACCTTGAAGAAGAGGAAGAAGATACAGAACGTGTT       c.1860
 Q  L  T  F  T  I  S  Y  D  L  E  E  E  E  E  D  T  E  R  V         p.620

          .         .     | 14   .         .         .         .    g.373979
 CTCCAGCTTATGATTATCTTAGAG | GGTAATGACTTGAGCATCAGCACAGCCCAAGATGAG    c.1920
 L  Q  L  M  I  I  L  E   | G  N  D  L  S  I  S  T  A  Q  D  E      p.640

          .         .         .         .         .         .       g.374039
 GTGTACCTGCACCCATCTGAAGAACATACTAATGTATTGTTACTTAAAGAAGAATCATTT       c.1980
 V  Y  L  H  P  S  E  E  H  T  N  V  L  L  L  K  E  E  S  F         p.660

          .         .         .         .         .         .       g.374099
 ACCATACATGGCACACATTTTCCAGTCCGTAGAAAGGAATTTATGACAGTGCTTGCGAAT       c.2040
 T  I  H  G  T  H  F  P  V  R  R  K  E  F  M  T  V  L  A  N         p.680

          .         .         .         .         .       | 15 .    g.382574
 TTGAAGAGAGTCCTCCTACAAATCACATACAGCTTTGGGATGGATGCCATCTTCAG | GTTG    c.2100
 L  K  R  V  L  L  Q  I  T  Y  S  F  G  M  D  A  I  F  R  |  L      p.700

          .         .         .         .         .         .       g.382634
 AGCTCTGTTAACCTTGAATCCGCTGTCTCCTATCCTACTGATGGAAGCATTGCAGCAGCT       c.2160
 S  S  V  N  L  E  S  A  V  S  Y  P  T  D  G  S  I  A  A  A         p.720

          .         .         .         .         | 16         .    g.388977
 GTAGAAGTGTGTCAGTGCCCACCAGGGTATACTGGCTCCTCTTGTGAA | TCTTGTTGGCCT    c.2220
 V  E  V  C  Q  C  P  P  G  Y  T  G  S  S  C  E   | S  C  W  P      p.740

          .         .         .         .         .         .       g.389037
 AGGCACAGGCGAGTTAACGGCACTATTTTTGGTGGCATCTGTGAGCCATGTCAGTGCTTT       c.2280
 R  H  R  R  V  N  G  T  I  F  G  G  I  C  E  P  C  Q  C  F         p.760

          .         .         .         .   | 17     .         .    g.392501
 GGTCATGCGGAGTCCTGTGATGACGTCACTGGAGAATGCCTG | AACTGTAAGGATCACACA    c.2340
 G  H  A  E  S  C  D  D  V  T  G  E  C  L   | N  C  K  D  H  T      p.780

          .         .         .         .         .         .       g.392561
 GGTGGCCCATATTGTGATAAATGTCTTCCTGGTTTCTATGGCGAGCCTACTAAAGGAACC       c.2400
 G  G  P  Y  C  D  K  C  L  P  G  F  Y  G  E  P  T  K  G  T         p.800

          .         .         .         .         . | 18       .    g.401930
 TCTGAAGACTGTCAACCCTGTGCCTGTCCACTCAATATCCCATCCAATAA | CTTTAGCCCA    c.2460
 S  E  D  C  Q  P  C  A  C  P  L  N  I  P  S  N  N  |  F  S  P      p.820

          .         .         .         .         .         .       g.401990
 ACGTGCCATTTAGACCGGAGTCTTGGATTGATCTGTGATGGATGCCCTGTCGGGTACACA       c.2520
 T  C  H  L  D  R  S  L  G  L  I  C  D  G  C  P  V  G  Y  T         p.840

          .        | 19.         .         .         .         .    g.409749
 GGACCACGCTGTGAGAG | GTGTGCAGAAGGCTATTTTGGACAACCCTCTGTACCTGGAGGA    c.2580
 G  P  R  C  E  R  |  C  A  E  G  Y  F  G  Q  P  S  V  P  G  G      p.860

          .         .         .         .         .         .       g.409809
 TCATGTCAGCCATGCCAATGCAATGACAACCTTGACTTCTCCATCCCTGGCAGCTGTGAC       c.2640
 S  C  Q  P  C  Q  C  N  D  N  L  D  F  S  I  P  G  S  C  D         p.880

          .         .         .         .         .         .       g.409869
 AGCTTGTCTGGCTCCTGTCTGATATGTAAACCAGGTACAACAGGCCGGTACTGTGAGCTC       c.2700
 S  L  S  G  S  C  L  I  C  K  P  G  T  T  G  R  Y  C  E  L         p.900

          .         .         .         .          | 20        .    g.413484
 TGTGCTGATGGATATTTTGGAGATGCAGTTGATGCGAAGAACTGTCAGC | CCTGTCGCTGT    c.2760
 C  A  D  G  Y  F  G  D  A  V  D  A  K  N  C  Q  P |   C  R  C      p.920

          .         .         .         .         .         .       g.413544
 AATGCCGGTGGCTCTTTCTCTGAGGTTTGCCACAGTCAAACTGGACAGTGTGAGTGCAGA       c.2820
 N  A  G  G  S  F  S  E  V  C  H  S  Q  T  G  Q  C  E  C  R         p.940

          .         .         .       | 21 .         .         .    g.419568
 GCCAACGTTCAGGGTCAGAGATGTGACAAATGCAAG | GCTGGGACCTTTGGCCTACAATCA    c.2880
 A  N  V  Q  G  Q  R  C  D  K  C  K   | A  G  T  F  G  L  Q  S      p.960

          .         .         .         .         .         .       g.419628
 GCAAGGGGCTGTGTTCCCTGCAACTGCAATTCTTTTGGGTCTAAGTCATTCGACTGTGAA       c.2940
 A  R  G  C  V  P  C  N  C  N  S  F  G  S  K  S  F  D  C  E         p.980

          .         .         .         .         .         .       g.419688
 GAGAGTGGACAATGTTGGTGCCAACCTGGAGTCACAGGGAAGAAATGTGACCGCTGTGCC       c.3000
 E  S  G  Q  C  W  C  Q  P  G  V  T  G  K  K  C  D  R  C  A         p.1000

          .         .         .        | 22.         .         .    g.422618
 CACGGCTATTTCAACTTCCAAGAAGGAGGCTGCACAG | CTTGTGAATGTTCTCATCTGGGT    c.3060
 H  G  Y  F  N  F  Q  E  G  G  C  T  A |   C  E  C  S  H  L  G      p.1020

          .         .         .         .         .         .       g.422678
 AATAATTGTGACCCAAAGACTGGGCGATGCATTTGCCCTCCCAATACCATTGGAGAGAAA       c.3120
 N  N  C  D  P  K  T  G  R  C  I  C  P  P  N  T  I  G  E  K         p.1040

          .         .         .         .         .     | 23   .    g.434726
 TGTTCTAAATGTGCACCCAATACCTGGGGCCACAGCATTACCACTGGTTGTAAG | GCTTGT    c.3180
 C  S  K  C  A  P  N  T  W  G  H  S  I  T  T  G  C  K   | A  C      p.1060

          .         .         .         .         .         .       g.434786
 AACTGCAGCACAGTGGGATCCTTGGATTTCCAATGCAATGTAAATACAGGCCAATGCAAC       c.3240
 N  C  S  T  V  G  S  L  D  F  Q  C  N  V  N  T  G  Q  C  N         p.1080

          .         .         .         .         .         .       g.434846
 TGTCATCCAAAATTCTCTGGTGCAAAATGTACAGAGTGCAGTCGAGGTCACTGGAACTAC       c.3300
 C  H  P  K  F  S  G  A  K  C  T  E  C  S  R  G  H  W  N  Y         p.1100

          .         .         .         .         .         .       g.434906
 CCTCGCTGCAATCTCTGTGACTGCTTCCTCCCTGGGACAGATGCCACAACCTGTGATTCA       c.3360
 P  R  C  N  L  C  D  C  F  L  P  G  T  D  A  T  T  C  D  S         p.1120

          .         .         .         .         .  | 24      .    g.436523
 GAGACTAAAAAATGCTCCTGTAGTGATCAAACTGGGCAGTGCACTTGTAAG | GTGAATGTG    c.3420
 E  T  K  K  C  S  C  S  D  Q  T  G  Q  C  T  C  K   | V  N  V      p.1140

          .         .         .         .         .         .       g.436583
 GAAGGCATCCACTGTGACAGATGCCGGCCTGGCAAATTCGGACTCGATGCCAAGAATCCA       c.3480
 E  G  I  H  C  D  R  C  R  P  G  K  F  G  L  D  A  K  N  P         p.1160

          .         .         .         .         .         .       g.436643
 CTTGGCTGCAGCAGCTGCTATTGCTTCGGCACTACTACCCAGTGCTCTGAAGCAAAAGGA       c.3540
 L  G  C  S  S  C  Y  C  F  G  T  T  T  Q  C  S  E  A  K  G         p.1180

          .      | 25  .         .         .         .         .    g.437380
 CTGATCCGGACGTGG | GTGACTCTGAAGGCTGAGCAGACCATTCTACCCCTGGTAGATGAG    c.3600
 L  I  R  T  W   | V  T  L  K  A  E  Q  T  I  L  P  L  V  D  E      p.1200

          .         .         .         .         .         .       g.437440
 GCTCTGCAGCACACGACCACCAAGGGCATTGTTTTTCAACATCCAGAGATTGTTGCCCAC       c.3660
 A  L  Q  H  T  T  T  K  G  I  V  F  Q  H  P  E  I  V  A  H         p.1220

          .         .         .         .         .         .       g.437500
 ATGGACCTGATGAGAGAAGATCTCCATTTGGAACCTTTTTATTGGAAACTTCCAGAACAA       c.3720
 M  D  L  M  R  E  D  L  H  L  E  P  F  Y  W  K  L  P  E  Q         p.1240

          .      | 26  .         .         .         .         .    g.437666
 TTTGAAGGAAAGAAG | TTGATGGCCTATGGGGGCAAACTCAAGTATGCAATCTATTTCGAG    c.3780
 F  E  G  K  K   | L  M  A  Y  G  G  K  L  K  Y  A  I  Y  F  E      p.1260

          .         .         .         .         .         .       g.437726
 GCTCGGGAAGAAACAGGTTTCTCTACATATAATCCTCAAGTGATCATTCGAGGTGGGACA       c.3840
 A  R  E  E  T  G  F  S  T  Y  N  P  Q  V  I  I  R  G  G  T         p.1280

          .         .         .         .         .         .       g.437786
 CCTACTCATGCTAGAATTATCGTCAGGCATATGGCTGCTCCTCTGATTGGCCAATTGACA       c.3900
 P  T  H  A  R  I  I  V  R  H  M  A  A  P  L  I  G  Q  L  T         p.1300

          .         .     | 27   .         .         .         .    g.437933
 AGGCATGAAATTGAAATGACAGAG | AAAGAATGGAAATATTATGGGGATGATCCTCGAGTC    c.3960
 R  H  E  I  E  M  T  E   | K  E  W  K  Y  Y  G  D  D  P  R  V      p.1320

          .         .         .         .         .         .       g.437993
 CATAGAACTGTGACCCGAGAAGACTTCTTGGATATACTATATGATATTCATTACATTCTT       c.4020
 H  R  T  V  T  R  E  D  F  L  D  I  L  Y  D  I  H  Y  I  L         p.1340

          .         .         .         | 28         .         .    g.442419
 ATCAAAGCTACTTATGGAAATTTCATGCGACAAAGCAG | GATTTCTGAAATCTCAATGGAG    c.4080
 I  K  A  T  Y  G  N  F  M  R  Q  S  R  |  I  S  E  I  S  M  E      p.1360

          .         .         .         .         .         .       g.442479
 GTAGCTGAACAAGGACGTGGAACAACAATGACTCCTCCAGCTGACTTGATTGAAAAATGT       c.4140
 V  A  E  Q  G  R  G  T  T  M  T  P  P  A  D  L  I  E  K  C         p.1380

          .         .         .       | 29 .         .         .    g.450161
 GATTGTCCCCTGGGCTATTCTGGCCTGTCCTGTGAG | GCATGCTTGCCGGGATTTTATCGA    c.4200
 D  C  P  L  G  Y  S  G  L  S  C  E   | A  C  L  P  G  F  Y  R      p.1400

          .         .         .         .         .         .       g.450221
 CTGCGTTCTCAACCAGGTGGCCGCACCCCTGGACCAACCCTGGGCACCTGTGTTCCATGT       c.4260
 L  R  S  Q  P  G  G  R  T  P  G  P  T  L  G  T  C  V  P  C         p.1420

          .         .         .         .         .  | 30      .    g.464211
 CAATGTAATGGACACAGCAGCCTGTGTGACCCTGAAACATCGATATGCCAG | AATTGTCAA    c.4320
 Q  C  N  G  H  S  S  L  C  D  P  E  T  S  I  C  Q   | N  C  Q      p.1440

          .         .         .         .         .         .       g.464271
 CATCACACTGCTGGTGACTTCTGTGAACGATGTGCTCTTGGATACTATGGAATTGTCAAG       c.4380
 H  H  T  A  G  D  F  C  E  R  C  A  L  G  Y  Y  G  I  V  K         p.1460

          .         .         .         .         .       | 31 .    g.471161
 GGATTGCCAAATGACTGTCAGCAATGTGCCTGCCCTCTGATTTCTTCCAGTAACAA | TTTC    c.4440
 G  L  P  N  D  C  Q  Q  C  A  C  P  L  I  S  S  S  N  N  |  F      p.1480

          .         .         .         .         .         .       g.471221
 AGCCCCTCTTGTGTCGCAGAAGGACTTGACGACTACCGCTGCACGGCTTGTCCACGGGGA       c.4500
 S  P  S  C  V  A  E  G  L  D  D  Y  R  C  T  A  C  P  R  G         p.1500

          .         .    | 32    .         .         .         .    g.475060
 TATGAAGGCCAGTACTGTGAAAG | GTGTGCCCCTGGCTATACTGGCAGTCCAGGCAACCCT    c.4560
 Y  E  G  Q  Y  C  E  R  |  C  A  P  G  Y  T  G  S  P  G  N  P      p.1520

          .          | .         .         .         .         .       g.475120
 GGAGGCTCCTGCCAAGAAT | GTGAGTGTGATCCCTATGGCTCACTGCCTGTGCCCTGTGAC       c.4620
 G  G  S  C  Q  E  C |   E  C  D  P  Y  G  S  L  P  V  P  C  D         p.1540
                       alternatively spliced
          .         .         .         .         .         .       g.475180
 CCTGTCACAGGATTCTGCACGTGCCGACCTGGAGCCACGGGAAGGAAGTGTGACGGCTGC       c.4680
 P  V  T  G  F  C  T  C  R  P  G  A  T  G  R  K  C  D  G  C         p.1560

          .         .         .        | 33.         .         .    g.488101
 AAGCACTGGCATGCACGCGAGGGCTGGGAGTGTGTTT | TTTGTGGAGATGAGTGCACTGGC    c.4740
 K  H  W  H  A  R  E  G  W  E  C  V  F |   C  G  D  E  C  T  G      p.1580

          .         .         .         .         .         .       g.488161
 CTTCTTCTCGGTGACTTGGCTCGCCTGGAGCAGATGGTCATGAGCATCAACCTCACTGGT       c.4800
 L  L  L  G  D  L  A  R  L  E  Q  M  V  M  S  I  N  L  T  G         p.1600

          .         .         .         .         .         .       g.488221
 CCGCTGCCTGCGCCATATAAAATGCTGTATGGTCTTGAAAATATGACTCAGGAGCTAAAG       c.4860
 P  L  P  A  P  Y  K  M  L  Y  G  L  E  N  M  T  Q  E  L  K         p.1620

  | 34       .         .         .         .         .         .    g.491811
  | CACTTGCTGTCACCTCAGCGGGCCCCAGAGAGGCTTATTCAGCTGGCAGAGGGCAATCTG    c.4920
  | H  L  L  S  P  Q  R  A  P  E  R  L  I  Q  L  A  E  G  N  L      p.1640

          .         .         .          | 35        .         .    g.505002
 AATACACTCGTGACCGAAATGAACGAGCTGCTGACCAGG | GCTACCAAAGTGACAGCAGAT    c.4980
 N  T  L  V  T  E  M  N  E  L  L  T  R   | A  T  K  V  T  A  D      p.1660

          .         .         .         .         .         .       g.505062
 GGCGAGCAGACCGGACAGGATGCTGAGAGGACCAACACAAGAGCAAAGTCCCTGGGAGAA       c.5040
 G  E  Q  T  G  Q  D  A  E  R  T  N  T  R  A  K  S  L  G  E         p.1680

          .         .         .  | 36      .         .         .    g.513379
 TTCATTAAGGAGCTTGCCCGGGATGCAGAAG | CTGTAAATGAAAAAGCTATAAAACTAAAT    c.5100
 F  I  K  E  L  A  R  D  A  E  A |   V  N  E  K  A  I  K  L  N      p.1700

          .         .         .         .         .         .       g.513439
 GAAACTCTAGGAACTCGAGACGAGGCCTTTGAGAGAAATTTGGAAGGGCTTCAGAAAGAG       c.5160
 E  T  L  G  T  R  D  E  A  F  E  R  N  L  E  G  L  Q  K  E         p.1720

          .         .         .         .         .         .       g.513499
 ATTGACCAGATGATTAAAGAACTGAGGAGGAAAAATCTAGAGACACAAAAGGAAATTGCT       c.5220
 I  D  Q  M  I  K  E  L  R  R  K  N  L  E  T  Q  K  E  I  A         p.1740

          .     | 37   .         .         .         .         .    g.514950
 GAAGATGAGTTGGT | AGCTGCAGAAGCCCTTCTGAAAAAAGTGAAGAAGCTGTTTGGAGAG    c.5280
 E  D  E  L  V  |  A  A  E  A  L  L  K  K  V  K  K  L  F  G  E      p.1760

          .         .         .         .         .         .       g.515010
 TCCCGGGGGGAAAATGAAGAAATGGAGAAGGATCTCCGGGAAAAACTGGCTGACTACAAA       c.5340
 S  R  G  E  N  E  E  M  E  K  D  L  R  E  K  L  A  D  Y  K         p.1780

          .         .         .         .         .         .       g.515070
 AACAAAGTTGATGATGCTTGGGACCTTTTGAGAGAAGCCACAGATAAAATCAGAGAAGCT       c.5400
 N  K  V  D  D  A  W  D  L  L  R  E  A  T  D  K  I  R  E  A         p.1800

          .         .         .         .      | 38  .         .    g.523098
 AATCGCCTATTTGCAGTAAATCAGAAAAACATGACTGCATTGGAG | AAAAAGAAGGAGGCT    c.5460
 N  R  L  F  A  V  N  Q  K  N  M  T  A  L  E   | K  K  K  E  A      p.1820

          .         .         .         .         .         .       g.523158
 GTTGAAAGCGGCAAACGACAAATTGAGAACACTTTAAAAGAGGGCAATGACATACTCGAT       c.5520
 V  E  S  G  K  R  Q  I  E  N  T  L  K  E  G  N  D  I  L  D         p.1840

          .         .         .         .   | 39     .         .    g.524201
 GAAGCCAACCGTCTTGCAGATGAAATCAACTCCATCATAGAC | TATGTTGAAGACATCCAA    c.5580
 E  A  N  R  L  A  D  E  I  N  S  I  I  D   | Y  V  E  D  I  Q      p.1860

          .         .         .         .         .         .       g.524261
 ACTAAATTGCCACCTATGTCTGAGGAGCTTAATGATAAAATAGATGACCTCTCCCAAGAA       c.5640
 T  K  L  P  P  M  S  E  E  L  N  D  K  I  D  D  L  S  Q  E         p.1880

          .         .         .         .         .         .       g.524321
 ATAAAGGACAGGAAGCTTGCTGAGAAGGTGTCCCAGGCTGAGAGCCACGCAGCTCAGTTG       c.5700
 I  K  D  R  K  L  A  E  K  V  S  Q  A  E  S  H  A  A  Q  L         p.1900

          .         .       | 40 .         .         .         .    g.525714
 AATGACTCATCTGCTGTCCTTGATGG | AATCCTTGATGAGGCTAAAAACATCTCCTTCAAT    c.5760
 N  D  S  S  A  V  L  D  G  |  I  L  D  E  A  K  N  I  S  F  N      p.1920

          .         .         .         .         .         .       g.525774
 GCCACTGCAGCCTTCAAAGCTTACAGCAATATTAAGGACTATATTGATGAAGCTGAGAAA       c.5820
 A  T  A  A  F  K  A  Y  S  N  I  K  D  Y  I  D  E  A  E  K         p.1940

          .         .         .         .      | 41  .         .    g.549626
 GTTGCCAAAGAAGCCAAAGATCTTGCACATGAAGCTACAAAACTG | GCAACAGGTCCTCGG    c.5880
 V  A  K  E  A  K  D  L  A  H  E  A  T  K  L   | A  T  G  P  R      p.1960

          .         .         .         .         .         .       g.549686
 GGTTTATTAAAGGAAGATGCCAAAGGCTGTCTTCAGAAAAGCTTCAGGATTCTTAACGAA       c.5940
 G  L  L  K  E  D  A  K  G  C  L  Q  K  S  F  R  I  L  N  E         p.1980

          .         .         | 42         .         .         .    g.560537
 GCCAAGAAGTTAGCAAATGATGTAAAAG | AAAATGAAGACCATCTAAATGGCTTAAAAACC    c.6000
 A  K  K  L  A  N  D  V  K  E |   N  E  D  H  L  N  G  L  K  T      p.2000

          .         .         .         .         .         .       g.560597
 AGGATAGAAAATGCTGATGCTAGAAATGGGGATCTCTTGAGAACTTTGAATGACACTTTG       c.6060
 R  I  E  N  A  D  A  R  N  G  D  L  L  R  T  L  N  D  T  L         p.2020

          .         .      | 43  .         .         .         .    g.562710
 GGAAAGTTATCAGCTATTCCAAATG | ATACAGCTGCTAAACTGCAAGCTGTTAAGGACAAA    c.6120
 G  K  L  S  A  I  P  N  D |   T  A  A  K  L  Q  A  V  K  D  K      p.2040

          .         .         .         .         .         .       g.562770
 GCCAGACAAGCCAACGACACAGCTAAAGATGTACTGGCACAGATTACAGAGCTCCACCAG       c.6180
 A  R  Q  A  N  D  T  A  K  D  V  L  A  Q  I  T  E  L  H  Q         p.2060

          .         .         .         .         .         .       g.562830
 AACCTCGATGGCCTGAAGAAGAATTACAATAAACTAGCAGACAGCGTCGCCAAAACGAAT       c.6240
 N  L  D  G  L  K  K  N  Y  N  K  L  A  D  S  V  A  K  T  N         p.2080

          .         .         | 44     | 45   .         .         . g.567552
 GCTGTGGTTAAAGATCCTTCCAAGAACA | AAATCA | TTGCCGATGCAGATGCCACTGTCAAA c.6300
 A  V  V  K  D  P  S  K  N  K |   I  I |   A  D  A  D  A  T  V  K   p.2100

          .         .         .         .         .         .       g.567612
 AATTTAGAACAGGAAGCTGACCGGCTAATAGATAAACTCAAACCCATCAAGGAACTTGAG       c.6360
 N  L  E  Q  E  A  D  R  L  I  D  K  L  K  P  I  K  E  L  E         p.2120

          .         .         .         .         .         .       g.567672
 GATAACCTAAAGAAAAACATCTCTGAGATAAAGGAATTGATAAACCAAGCTCGGAAACAA       c.6420
 D  N  L  K  K  N  I  S  E  I  K  E  L  I  N  Q  A  R  K  Q         p.2140

           | 46        .         .         .         .         .    g.574898
 GCCAATTCT | ATCAAAGTATCTGTGTCTTCAGGAGGTGACTGCATTCGAACATACAAACCA    c.6480
 A  N  S   | I  K  V  S  V  S  S  G  G  D  C  I  R  T  Y  K  P      p.2160

          .         .         .         .         .         .       g.574958
 GAAATCAAGAAAGGAAGTTACAATAATATTGTTGTCAACGTAAAGACAGCTGTTGCTGAT       c.6540
 E  I  K  K  G  S  Y  N  N  I  V  V  N  V  K  T  A  V  A  D         p.2180

          .         .         .    | 47    .         .         .    g.576041
 AACCTCCTCTTTTATCTTGGAAGTGCCAAATTT | ATTGACTTTCTGGCTATAGAAATGCGT    c.6600
 N  L  L  F  Y  L  G  S  A  K  F   | I  D  F  L  A  I  E  M  R      p.2200

          .         .         .         .         .         .       g.576101
 AAAGGCAAAGTCAGCTTCCTCTGGGATGTTGGATCTGGAGTTGGACGTGTAGAGTACCCA       c.6660
 K  G  K  V  S  F  L  W  D  V  G  S  G  V  G  R  V  E  Y  P         p.2220

          .         .         .         .        | 48.         .    g.578207
 GATTTGACTATTGATGACTCATATTGGTACCGTATCGTAGCATCAAG | AACTGGGAGAAAT    c.6720
 D  L  T  I  D  D  S  Y  W  Y  R  I  V  A  S  R  |  T  G  R  N      p.2240

          .         .         .         .         .         .       g.578267
 GGAACTATTTCTGTGAGAGCCCTGGATGGACCCAAAGCCAGCATTGTGCCCAGCACACAC       c.6780
 G  T  I  S  V  R  A  L  D  G  P  K  A  S  I  V  P  S  T  H         p.2260

          .         .         .         .         .         .       g.578327
 CATTCGACGTCTCCTCCAGGGTACACGATTCTAGATGTGGATGCAAATGCAATGCTGTTT       c.6840
 H  S  T  S  P  P  G  Y  T  I  L  D  V  D  A  N  A  M  L  F         p.2280

          .         .        | 49.         .         .         .    g.582092
 GTTGGTGGCCTGACTGGGAAATTAAAG | AAGGCTGATGCTGTACGTGTGATTACATTCACT    c.6900
 V  G  G  L  T  G  K  L  K   | K  A  D  A  V  R  V  I  T  F  T      p.2300

          .         .         .         .         .         .       g.582152
 GGCTGCATGGGAGAAACATACTTTGACAACAAACCTATAGGTTTGTGGAATTTCCGAGAA       c.6960
 G  C  M  G  E  T  Y  F  D  N  K  P  I  G  L  W  N  F  R  E         p.2320

          .         .         .   | 50     .         .         .    g.586177
 AAAGAAGGTGACTGCAAAGGATGCACTGTCAG | TCCTCAGGTGGAAGATAGTGAGGGGACT    c.7020
 K  E  G  D  C  K  G  C  T  V  S  |  P  Q  V  E  D  S  E  G  T      p.2340

          .         .         .         .         .         .       g.586237
 ATTCAATTTGATGGAGAAGGTTATGCATTGGTCAGCCGTCCCATTCGCTGGTACCCCAAC       c.7080
 I  Q  F  D  G  E  G  Y  A  L  V  S  R  P  I  R  W  Y  P  N         p.2360

          .         .         .         .         .         .       g.586297
 ATCTCCACTGTCATGTTCAAGTTCAGAACATTTTCTTCGAGTGCTCTTCTGATGTATCTT       c.7140
 I  S  T  V  M  F  K  F  R  T  F  S  S  S  A  L  L  M  Y  L         p.2380

          .      | 51  .         .         .         .         .    g.587049
 GCCACACGAGACCTG | AGAGATTTCATGAGTGTGGAGCTCACTGATGGGCACATAAAAGTC    c.7200
 A  T  R  D  L   | R  D  F  M  S  V  E  L  T  D  G  H  I  K  V      p.2400

          .         .         .         .         .         .       g.587109
 AGTTACGATCTGGGCTCAGGAATGGCTTCCGTTGTCAGCAATCAAAACCATAATGATGGG       c.7260
 S  Y  D  L  G  S  G  M  A  S  V  V  S  N  Q  N  H  N  D  G         p.2420

          .         .         .         . | 52       .         .    g.595093
 AAATGGAAATCATTCACTCTGTCAAGAATTCAAAAACAAG | CCAATATATCAATTGTAGAT    c.7320
 K  W  K  S  F  T  L  S  R  I  Q  K  Q  A |   N  I  S  I  V  D      p.2440

          .         .         .         .         .         .       g.595153
 ATAGATACTAATCAGGAGGAGAATATAGCAACTTCGTCTTCTGGAAACAACTTTGGTCTT       c.7380
 I  D  T  N  Q  E  E  N  I  A  T  S  S  S  G  N  N  F  G  L         p.2460

          .         .         .         .         .          | 53    g.597250
 GACTTGAAAGCAGATGACAAAATATATTTTGGTGGCCTGCCAACGCTGAGAAACTTGAG | T    c.7440
 D  L  K  A  D  D  K  I  Y  F  G  G  L  P  T  L  R  N  L  S  |      p.2480
                                                               alternatively spliced

          .  | 54      .         .         .         .         .    g.600601
 ATGAAAGCAAG | GCCAGAAGTAAATCTGAAGAAATATTCCGGCTGCCTCAAAGATATTGAA    c.7500
 M  K  A  R  |  P  E  V  N  L  K  K  Y  S  G  C  L  K  D  I  E      p.2500

          .         .         .         .         .         .       g.600661
 ATTTCAAGAACTCCGTACAATATACTCAGTAGTCCCGATTATGTTGGTGTTACCAAAGGA       c.7560
 I  S  R  T  P  Y  N  I  L  S  S  P  D  Y  V  G  V  T  K  G         p.2520

          .   | 55     .         .         .         .         .    g.603170
 TGTTCCCTGGAG | AATGTTTACACAGTTAGCTTTCCTAAGCCTGGTTTTGTGGAGCTCTCC    c.7620
 C  S  L  E   | N  V  Y  T  V  S  F  P  K  P  G  F  V  E  L  S      p.2540

          .         .         .         .         .         .       g.603230
 CCTGTGCCAATTGATGTAGGAACAGAAATCAACCTGTCATTCAGCACCAAGAATGAGTCC       c.7680
 P  V  P  I  D  V  G  T  E  I  N  L  S  F  S  T  K  N  E  S         p.2560

          .         .         .         .         .         .       g.603290
 GGCATCATTCTTTTGGGAAGTGGAGGGACACCAGCACCACCTAGGAGAAAACGAAGGCAG       c.7740
 G  I  I  L  L  G  S  G  G  T  P  A  P  P  R  R  K  R  R  Q         p.2580

           | 56        .         .         .         .         .    g.608384
 ACTGGACAG | GCCTATTATGTAATACTCCTCAACAGGGGCCGTCTGGAAGTGCATCTCTCC    c.7800
 T  G  Q   | A  Y  Y  V  I  L  L  N  R  G  R  L  E  V  H  L  S      p.2600

          .         .         .         .         .         .       g.608444
 ACAGGGGCACGAACAATGAGGAAAATTGTGATCAGACCAGAGCCGAATCTGTTTCATGAT       c.7860
 T  G  A  R  T  M  R  K  I  V  I  R  P  E  P  N  L  F  H  D         p.2620

          .         .         .         | 57         .         .    g.613782
 GGAAGAGAACATTCCGTTCATGTAGAGCGAACTAGAGG | CATCTTTACAGTTCAAGTGGAT    c.7920
 G  R  E  H  S  V  H  V  E  R  T  R  G  |  I  F  T  V  Q  V  D      p.2640

          .         .         .         .         .         .       g.613842
 GAAAACAGAAGATACATGCAAAACCTGACAGTTGAACAGCCTATCGAAGTTAAAAAGCTT       c.7980
 E  N  R  R  Y  M  Q  N  L  T  V  E  Q  P  I  E  V  K  K  L         p.2660

          .         .         .         .         .         .       g.613902
 TTCGTTGGGGGTGCTCCACCTGAATTTCAACCTTCCCCACTCAGAAATATTCCTCCTTTT       c.8040
 F  V  G  G  A  P  P  E  F  Q  P  S  P  L  R  N  I  P  P  F         p.2680

          .         .         .      | 58  .         .         .    g.614199
 GAAGGCTGCATATGGAATCTTGTTATTAACTCTGT | CCCCATGGACTTTGCAAGGCCTGTG    c.8100
 E  G  C  I  W  N  L  V  I  N  S  V  |  P  M  D  F  A  R  P  V      p.2700

          .         .         .         .         .         .       g.614259
 TCCTTCAAAAATGCTGACATTGGTCGCTGTGCCCATCAGAAACTCCGTGAAGATGAAGAT       c.8160
 S  F  K  N  A  D  I  G  R  C  A  H  Q  K  L  R  E  D  E  D         p.2720

          .         .         .         .         .         .       g.614319
 GGAGCAGCTCCAGCTGAAATAGTTATCCAGCCTGAGCCAGTTCCCACCCCAGCCTTTCCT       c.8220
 G  A  A  P  A  E  I  V  I  Q  P  E  P  V  P  T  P  A  F  P         p.2740

          .         .     | 59   .         .         .         .    g.624554
 ACGCCCACCCCAGTTCTGACACAT | GGTCCTTGTGCTGCAGAATCAGAACCAGCTCTTTTG    c.8280
 T  P  T  P  V  L  T  H   | G  P  C  A  A  E  S  E  P  A  L  L      p.2760

          .         .         .         .         .         .       g.624614
 ATAGGGAGCAAGCAGTTCGGGCTTTCAAGAAACAGTCACATTGCAATTGCATTTGATGAC       c.8340
 I  G  S  K  Q  F  G  L  S  R  N  S  H  I  A  I  A  F  D  D         p.2780

          .        | 60.         .         .         .         .    g.624993
 ACCAAAGTTAAAAACCG | TCTCACAATTGAGTTGGAAGTAAGAACCGAAGCTGAATCCGGC    c.8400
 T  K  V  K  N  R  |  L  T  I  E  L  E  V  R  T  E  A  E  S  G      p.2800

          .         .         .         .         .         .       g.625053
 TTGCTTTTTTACATGGCTCGCATCAATCATGCTGATTTTGCAACAGTTCAGCTGAGAAAT       c.8460
 L  L  F  Y  M  A  R  I  N  H  A  D  F  A  T  V  Q  L  R  N         p.2820

          .         .         .         .         .         .       g.625113
 GGATTGCCCTACTTCAGCTATGACTTGGGGAGTGGGGACACCCACACCATGATCCCCACC       c.8520
 G  L  P  Y  F  S  Y  D  L  G  S  G  D  T  H  T  M  I  P  T         p.2840

          .         .        | 61.         .         .         .    g.627092
 AAAATCAATGATGGCCAGTGGCACAAG | ATTAAGATAATGAGAAGTAAGCAAGAAGGAATT    c.8580
 K  I  N  D  G  Q  W  H  K   | I  K  I  M  R  S  K  Q  E  G  I      p.2860

          .         .         .         .         .         .       g.627152
 CTTTATGTAGATGGGGCTTCCAACAGAACCATCAGTCCCAAAAAAGCCGACATCCTGGAT       c.8640
 L  Y  V  D  G  A  S  N  R  T  I  S  P  K  K  A  D  I  L  D         p.2880

          .         .         .         .         .         .       g.627212
 GTCGTGGGAATGCTGTATGTTGGTGGGTTACCCATCAACTACACTACCCGAAGAATTGGT       c.8700
 V  V  G  M  L  Y  V  G  G  L  P  I  N  Y  T  T  R  R  I  G         p.2900

     | 62    .         .         .         .         .         .    g.629405
 CCA | GTGACCTATAGCATTGATGGCTGCGTCAGGAATCTCCACATGGCAGAGGCCCCTGCC    c.8760
 P   | V  T  Y  S  I  D  G  C  V  R  N  L  H  M  A  E  A  P  A      p.2920

          .         .         .         .         .         .       g.629465
 GATCTGGAACAACCCACCTCCAGCTTCCATGTTGGGACATGTTTTGCAAATGCTCAGAGG       c.8820
 D  L  E  Q  P  T  S  S  F  H  V  G  T  C  F  A  N  A  Q  R         p.2940

          .         .         .        | 63.         .         .    g.634245
 GGAACATATTTTGACGGAACCGGTTTTGCCAAAGCAG | TTGGTGGATTCAAAGTGGGATTG    c.8880
 G  T  Y  F  D  G  T  G  F  A  K  A  V |   G  G  F  K  V  G  L      p.2960

          .         .         .         .         .         .       g.634305
 GACCTTCTTGTAGAATTTGAATTCCGCACAACTACAACGACTGGAGTTCTTCTGGGGATC       c.8940
 D  L  L  V  E  F  E  F  R  T  T  T  T  T  G  V  L  L  G  I         p.2980

          .         .         .         .         | 64         .    g.636244
 AGTAGTCAAAAAATGGATGGAATGGGTATTGAAATGATTGATGAAAAG | TTGATGTTTCAT    c.9000
 S  S  Q  K  M  D  G  M  G  I  E  M  I  D  E  K   | L  M  F  H      p.3000

          .         .         .         .         .         .       g.636304
 GTGGACAATGGTGCGGGCAGATTCACTGCTGTCTATGATGCTGGGGTTCCAGGGCATTTG       c.9060
 V  D  N  G  A  G  R  F  T  A  V  Y  D  A  G  V  P  G  H  L         p.3020

          .         .         .         .         .         .       g.636364
 TGTGATGGACAATGGCATAAAGTCACTGCCAACAAGATCAAACACCGCATTGAGCTCACA       c.9120
 C  D  G  Q  W  H  K  V  T  A  N  K  I  K  H  R  I  E  L  T         p.3040

          .         .         .         .         .         .       g.636424
 GTCGATGGGAACCAGGTGGAAGCCCAAAGCCCAAACCCAGCATCTACATCAGCTGACACA       c.9180
 V  D  G  N  Q  V  E  A  Q  S  P  N  P  A  S  T  S  A  D  T         p.3060

          .         .         .  | 65      .         .         .    g.638078
 AATGACCCTGTGTTTGTTGGAGGCTTCCCAG | ATGACCTCAAGCAGTTTGGCCTAACAACC    c.9240
 N  D  P  V  F  V  G  G  F  P  D |   D  L  K  Q  F  G  L  T  T      p.3080

          .         .         .         .         .         .       g.638138
 AGTATTCCGTTCCGAGGTTGCATCAGATCCCTGAAGCTCACCAAAGGCACAGGCAAGCCA       c.9300
 S  I  P  F  R  G  C  I  R  S  L  K  L  T  K  G  T  G  K  P         p.3100

          .         .         .         .         .         .       g.638198
 CTGGAGGTTAATTTTGCCAAGGCCCTGGAACTGAGGGGCGTTCAACCTGTATCATGCCCA       c.9360
 L  E  V  N  F  A  K  A  L  E  L  R  G  V  Q  P  V  S  C  P         p.3120

                                                                    g.638207
 GCCAACTAA                                                          c.9369
 A  N  X                                                            p.3122

          .         .         .         .         .         .       g.638267
 taaaaataagtgtaaccccaggaagagtctgtcaaaacaagtatatcaagtaaaacaaac       c.*60

          .         .         .         .         .         .       g.638327
 aaatatattttacctatatatgttaattaaactaatttgtgcatgtacatagaattcttt       c.*120

          .         .         .         .         .         .       g.638387
 ctgtattcagatggtgctaattcagactccagactgaattttaattcaagttctttctca       c.*180

          .         .         .                                     g.638426
 agtctataaataatattaaactgattatttcattctaaa                            c.*219

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Laminin-alpha 2 (merosin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center