Calpain-3 (CAPN3) - coding DNA reference sequence

(used for mutation description)

(last modified February 4, 2011)


This file was created to facilitate the description of sequence variants in the CAPN3 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008660.1, covering CAPN3 transcript NM_000070.2. Several differentially spliced CAPN3-transcripts have been described; variant-2 (NM_024344.1) lacking exon 15 and variant-3 (NM_173087.1) lacking exons 6, 15 and 16. Transcript variant-7 (NM_212465.2) uses an upstream promoter/first exon 01b and 5 exons replacing the normal exon 1 and lacks exon 15. Other transcripts use an alterantive promoter/first-exon in intron 12 (variant-4, NM_173088.1) or intron 14 (variant-6 lacking exon 16, NM_173090.1) and variant-5 (lacking exons 15 and 16, NM_173089.1).

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
           ^  alternative promoter/first exon 01b
                                                                    g.16403
                                                       cactct       c.-301

 .         .         .         .         .         .                g.16463
 ctttctctctccctctggcatgcatgctgctggtaggagacccccaagtcaacattgctt       c.-241

 .         .         .         .         .         .                g.16523
 cagaaatcctttagcactcatttctcaggagaacttatggcttcagaatcacagctcggt       c.-181

 .         .         .         .         .         .                g.16583
 ttttaagatggacataacctgtacgaccttctgatgggctttcaactttgaactggatgt       c.-121

 .         .         .         .         .         .                g.16643
 ggacacttttctctcagatgacagaattactccaacttcccctttgcagttgcttccttt       c.-61

 .         .         .         .         .         .                g.16703
 ccttgaaggtagctgtatcttattttctttaaaaagctttttcttccaaagccacttgcc       c.-1

          .         .         .         .         .         .       g.16763
 ATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCA       c.60
 M  P  T  V  I  S  A  S  V  A  P  R  T  A  A  E  P  R  S  P         p.20

          .         .         .         .         .         .       g.16823
 GGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGT       c.120
 G  P  V  P  H  P  A  Q  S  K  A  T  E  A  G  G  G  N  P  S         p.40

          .         .         .         .         .         .       g.16883
 GGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACA       c.180
 G  I  Y  S  A  I  I  S  R  N  F  P  I  I  G  V  K  E  K  T         p.60

          .         .         .         .         .         .       g.16943
 TTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTC       c.240
 F  E  Q  L  H  K  K  C  L  E  K  K  V  L  Y  V  D  P  E  F         p.80

          .         .         .         .         .         .       g.17003
 CCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAG       c.300
 P  P  D  E  T  S  L  F  Y  S  Q  K  F  P  I  Q  F  V  W  K         p.100

           | 02        .         .         .         .         .    g.41431
 AGACCTCCG | GAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGAC    c.360
 R  P  P   | E  I  C  E  N  P  R  F  I  I  D  G  A  N  R  T  D      p.120

          .          | 03        .         .         .         .    g.43105
 ATCTGTCAAGGAGAGCTAG | GGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTG    c.420
 I  C  Q  G  E  L  G |   D  C  W  F  L  A  A  I  A  C  L  T  L      p.140

          .         .         .         .         .         .       g.43165
 AACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCA       c.480
 N  Q  H  L  L  F  R  V  I  P  H  D  Q  S  F  I  E  N  Y  A         p.160

          .         | 04         .         .         .         .    g.44692
 GGGATCTTCCACTTCCAG | TTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGAC    c.540
 G  I  F  H  F  Q   | F  W  R  Y  G  E  W  V  D  V  V  I  D  D      p.180

          .         .         .         .         .         .       g.44752
 TGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTC       c.600
 C  L  P  T  Y  N  N  Q  L  V  F  T  K  S  N  H  R  N  E  F         p.200

          .         .         .   | 05     .         .         .    g.45853
 TGGAGTGCTCTGCTGGAGAAGGCTTATGCTAA | GCTCCATGGTTCCTACGAAGCTCTGAAA    c.660
 W  S  A  L  L  E  K  A  Y  A  K  |  L  H  G  S  Y  E  A  L  K      p.220

          .         .         .         .         .         .       g.45913
 GGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAG       c.720
 G  G  N  T  T  E  A  M  E  D  F  T  G  G  V  A  E  F  F  E         p.240

          .         .         .         .         .         .       g.45973
 ATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCC       c.780
 I  R  D  A  P  S  D  M  Y  K  I  M  K  K  A  I  E  R  G  S         p.260

          .         .  | 06      .         .         .         .    g.46889
 CTCATGGGCTGCTCCATTGAT | GATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGT    c.840
 L  M  G  C  S  I  D   | D  G  T  N  M  T  Y  G  T  S  P  S  G      p.280

          .         .         .         .         .         .       g.46949
 CTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAG       c.900
 L  N  M  G  E  L  I  A  R  M  V  R  N  M  D  N  S  L  L  Q         p.300

          .         .         .         .      | 07  .         .    g.49551
 GACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGG | ACAATCATTCCGGTT    c.960
 D  S  D  L  D  P  R  G  S  D  E  R  P  T  R   | T  I  I  P  V      p.320

          .         .         .         .         .         .       g.49611
 CAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGG       c.1020
 Q  Y  E  T  R  M  A  C  G  L  V  R  G  H  A  Y  S  V  T  G         p.340

           | 08        .         .         .         .         .    g.51204
 CTGGATGAG | GTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGG    c.1080
 L  D  E   | V  P  F  K  G  E  K  V  K  L  V  R  L  R  N  P  W      p.360

          .         .         .      | 09  .         .         .    g.53722
 GGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAG | ATGGAAGGACTGGAGCTTTGTGGAC    c.1140
 G  Q  V  E  W  N  G  S  W  S  D  R  |  W  K  D  W  S  F  V  D      p.380

          .         .         .         .         .    | 10    .    g.56396
 AAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTG | GATGTCC    c.1200
 K  D  E  K  A  R  L  Q  H  Q  V  T  E  D  G  E  F  W  |  M  S      p.400

          .         .         .         .         .         .       g.56456
 TATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCGATGCT       c.1260
 Y  E  D  F  I  Y  H  F  T  K  L  E  I  C  N  L  T  A  D  A         p.420

          .         .         .         .         .         .       g.56516
 CTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGG       c.1320
 L  Q  S  D  K  L  Q  T  W  T  V  S  V  N  E  G  R  W  V  R         p.440

          .         .         .     | 11   .         .         .    g.58564
 GGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAG | ATACTTTCTGGACCAACCCTCAGTAC    c.1380
 G  C  S  A  G  G  C  R  N  F  P  D |   T  F  W  T  N  P  Q  Y      p.460

          .         .         .         .         .         .       g.58624
 CGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTC       c.1440
 R  L  K  L  L  E  E  D  D  D  P  D  D  S  E  V  I  C  S  F         p.480

          .         .         .         .         .         .       g.58684
 CTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTC       c.1500
 L  V  A  L  M  Q  K  N  R  R  K  D  R  K  L  G  A  S  L  F         p.500

          .         .     | 12   .       | 13 .         .         . g.59715
 ACCATTGGCTTCGCCATCTACGAG | GTTCCCAAAGAG | ATGCACGGGAACAAGCAGCACCTG c.1560
 T  I  G  F  A  I  Y  E   | V  P  K  E   | M  H  G  N  K  Q  H  L   p.520
                                         ^  alternative promoter/first exon 13b

          .         .         .         .         .         .       g.59775
 CAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATG       c.1620
 Q  K  D  F  F  L  Y  N  A  S  K  A  R  S  K  T  Y  I  N  M         p.540

          .         .         .         .         .         .       g.59835
 CGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACC       c.1680
 R  E  V  S  Q  R  F  R  L  P  P  S  E  Y  V  I  V  P  S  T         p.560

          .         .         .         .         .         .       g.59895
 TACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTC       c.1740
 Y  E  P  H  Q  E  G  E  F  I  L  R  V  F  S  E  K  R  N  L         p.580

       | 14  .         .         .         .   | 15     .         . g.62841
 TCTGA | GGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTG | AAAAAGAAAAAAACCAAG c.1800
 S  E  |  E  V  E  N  T  I  S  V  D  R  P  V   | K  K  K  K  T  K   p.600
                                               ^  alternative promoter/first exon 15b

  | 16       .         .         .         .         .         .    g.65168
  | CCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAG    c.1860
  | P  I  I  F  V  S  D  R  A  N  S  N  K  E  L  G  V  D  Q  E      p.620

          .         .         .         .         .     | 17   .    g.66206
 TCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAG | CCACAG    c.1920
 S  E  E  G  K  G  K  T  S  P  D  K  Q  K  Q  S  P  Q   | P  Q      p.640

          .         .         .         .         .         .       g.66266
 CCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAG       c.1980
 P  G  S  S  D  Q  E  S  E  E  Q  Q  Q  F  R  N  I  F  K  Q         p.660

          .   | 18     .         .         .         .         .    g.66732
 ATAGCAGGAGAT | GACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTC    c.2040
 I  A  G  D   | D  M  E  I  C  A  D  E  L  K  K  V  L  N  T  V      p.680

          . | 19       .         .         .         .         .    g.66878
 GTGAACAAAC | ACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATG    c.2100
 V  N  K  H |   K  D  L  K  T  H  G  F  T  L  E  S  C  R  S  M      p.700

          .      | 20  .         .         .         .         .    g.67370
 ATTGCGCTCATGGAT | ACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTC    c.2160
 I  A  L  M  D   | T  D  G  S  G  K  L  N  L  Q  E  F  H  H  L      p.720

          .         .     | 21   .         .         .         .    g.67521
 TGGAACAAGATTAAGGCCTGGCAG | AAAATTTTCAAACACTATGACACAGACCAGTCCGGC    c.2220
 W  N  K  I  K  A  W  Q   | K  I  F  K  H  Y  D  T  D  Q  S  G      p.740

          .         .         .         .    | 22    .         .    g.67798
 ACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAG | GATTCCACCTCAACAAC    c.2280
 T  I  N  S  Y  E  M  R  N  A  V  N  D  A  G |   F  H  L  N  N      p.760

          .         .         .         .         .         .       g.67858
 CAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGAC       c.2340
 Q  L  Y  D  I  I  T  M  R  Y  A  D  K  H  M  N  I  D  F  D         p.780

          .         .         .         . | 23       .         .    g.68204
 AGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCA | GAGCTTTTCATGCATTTGAC    c.2400
 S  F  I  C  C  F  V  R  L  E  G  M  F  R |   A  F  H  A  F  D      p.800

          .         .         .          | 24        .         .    g.68665
 AAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAG | TGGCTGCAGCTCACCATGTAT    c.2460
 K  D  G  D  G  I  I  K  L  N  V  L  E   | W  L  Q  L  T  M  Y      p.820

                                                                    g.68671
 GCCTGA                                                             c.2466
 A  X                                                               p.821

          .         .         .         .         .         .       g.68731
 accaggctggcctcatccaaagccatgcaggatcactcaggatttcagtttcaccctcta       c.*60

          .         .         .         .         .         .       g.68791
 tttccaaagccatttacctcaaaggacccagcagctacacccctacaggcttccaggcac       c.*120

          .         .         .         .         .         .       g.68851
 ctcatcagtcatgctcctcctccattttaccccctacccatccttgatcggtcatgccta       c.*180

          .         .         .         .         .         .       g.68911
 gcctgaccctttagtaaagcaatgaggtaggaagaacaaacccttgtccctttgccatgt       c.*240

          .         .         .         .         .         .       g.68971
 ggaggaaagtgcctgcctctggtccgagccgcctcggttctgaagcgagtgctcctgctt       c.*300

          .         .         .         .         .         .       g.69031
 accttgctctaggctgtctgcagaagcacctgccggtggcactcagcacctccttgtgct       c.*360

          .         .         .         .         .         .       g.69091
 agagccctccatcaccttcacgctgtcccaccatgggccaggaaccaaaccagcactggg       c.*420

          .         .         .         .         .         .       g.69151
 ttctactgctgtggggtaaactaactcagtggaatagggctggttactttgggctgtcca       c.*480

          .         .         .         .         .         .       g.69211
 actcataagtttggctgcattttgaaaaaagctgatctaaataaaggcatgtgtatggct       c.*540

                                                                    g.69215
 ggtc                                                               c.*544

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Calpain-3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center