Berardinelli-Seip congenital lipodystrophy 2 (seipin) (BSCL2) - coding DNA reference sequence

(used for mutation description)

(last modified March 20, 2012)


This file was created to facilitate the description of sequence variants in the BSCL2 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008461.1, covering BSCL2 transcript variant-1 (NM_001122955.3). Several papers have reported variants in relation to transcript variant-2 (NM_032667.6), using an alternative promoter/exon 1b in intron 1 and a transcription initiation site in exon 2 (Met-65). Transcript variant-3  (NM_001130702.2) uses the same promoter but skips exon 7, generating an alternatively translated C-terminal protein.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                               .         .         .                g.6899
                             gctggtacctgaaggatgaaggatgctagaag       c.-481

 .         .         .         .         .         .                g.6959
 gagctgctcagatcctggagcataccaactgcctggccagtgggggagcctagctgcctg       c.-421

 .         .         .         .         .         .                g.7019
 catccctgcgcacacccccactgtcgctagttcactgcctgcccctcccccattgcaggc       c.-361

 .         .         .         .         .         .                g.7079
 atcctgactctgggctagagacctccccaacagagctgaggccaaggccgactccccctc       c.-301

 .         .         .         .         .         .                g.7139
 tcaaatggcgtggtctgggcctatgacggcccctgcagtggagtctgtactggctgcggg       c.-241

 .         .         .         .         .         .                g.7199
 ggaccctgctcatttgaaaatctgacatcagctgggcagtcgcccccctcctcctttcct       c.-181

 .         .         .         .         .         .                g.7259
 ccctctactctgacacagcacttagcacctgaatcttcgtttctctcccagggaccctcc       c.-121

 .         .         .         .         .         .                g.7319
 attttccatatccaggaaaatgtgatgcgccacaggtatcagcgtctggatcgccacttc       c.-61

 .         .         .         .         .         .                g.7379
 acgttttagccacaagtgactcagtggaagatccagagtcaacagaggctcgtcaggaag       c.-1

          .         .         .         .         .         .       g.7439
 ATGTCTACAGAAAAGGTAGACCAAAAGGAGGAAGCTGGGGAAAAAGAGGTGTGCGGAGAC       c.60
 M  S  T  E  K  V  D  Q  K  E  E  A  G  E  K  E  V  C  G  D         p.20

          .         .        | 02.         .         .         .    g.8990
 CAGATCAAAGGACCGGACAAAGAGGAG | GAACCACCAGCTGCTGCATCCCATGGCCAGGGG    c.120
 Q  I  K  G  P  D  K  E  E   | E  P  P  A  A  A  S  H  G  Q  G      p.40

          .         .         .         .         .         .       g.9050
 TGGCGTCCAGGTGGCAGAGCAGCTAGGAACGCAAGGCCTGAACCTGGGGCCAGACACCCT       c.180
 W  R  P  G  G  R  A  A  R  N  A  R  P  E  P  G  A  R  H  P         p.60

          .         .         .         .         .         .       g.9110
 GCTCTCCCGGCCATGGTCAACGACCCTCCAGTACCTGCCTTACTGTGGGCCCAGGAGGTG       c.240
 A  L  P  A  M  V  N  D  P  P  V  P  A  L  L  W  A  Q  E  V         p.80  /16
             ^ translation start isoform-2

          .         .         .         .         .         .       g.9170
 GGCCAAGTCTTGGCAGGCCGTGCCCGCAGGCTGCTGCTGCAGTTTGGGGTGCTCTTCTGC       c.300
 G  Q  V  L  A  G  R  A  R  R  L  L  L  Q  F  G  V  L  F  C         p.100  /36

          .         .         .         .         .         .       g.9230
 ACCATCCTCCTTTTGCTCTGGGTGTCTGTCTTCCTCTATGGCTCCTTCTACTATTCCTAT       c.360
 T  I  L  L  L  L  W  V  S  V  F  L  Y  G  S  F  Y  Y  S  Y         p.120  /56

          .         .         .         .     | 03   .         .    g.12041
 ATGCCGACAGTCAGCCACCTCAGCCCTGTGCATTTCTACTACAG | GACCGACTGTGATTCC    c.420
 M  P  T  V  S  H  L  S  P  V  H  F  Y  Y  R  |  T  D  C  D  S      p.140  /76

          .         .         .         .         .         .       g.12101
 TCCACCACCTCACTCTGCTCCTTCCCTGTTGCCAATGTCTCGCTGACTAAGGGTGGACGT       c.480
 S  T  T  S  L  C  S  F  P  V  A  N  V  S  L  T  K  G  G  R         p.160  /96

        | 04 .         .         .         .         .         .    g.19917
 GATCGG | GTGCTGATGTATGGACAGCCGTATCGTGTTACCTTAGAGCTTGAGCTGCCAGAG    c.540
 D  R   | V  L  M  Y  G  Q  P  Y  R  V  T  L  E  L  E  L  P  E      p.180  /116

          .         .         .         .         .         .       g.19977
 TCCCCTGTGAATCAAGATTTGGGCATGTTCTTGGTCACCATTTCCTGCTACACCAGAGGT       c.600
 S  P  V  N  Q  D  L  G  M  F  L  V  T  I  S  C  Y  T  R  G         p.200  /136

          .         .         . | 05       .         .         .    g.21807
 GGCCGAATCATCTCCACTTCTTCGCGTTCG | GTGATGCTGCATTACCGCTCAGACCTGCTC    c.660
 G  R  I  I  S  T  S  S  R  S   | V  M  L  H  Y  R  S  D  L  L      p.220  /156

          .         .         .         .         .         .       g.21867
 CAGATGCTGGACACACTGGTCTTCTCTAGCCTCCTGCTATTTGGCTTTGCAGAGCAGAAG       c.720
 Q  M  L  D  T  L  V  F  S  S  L  L  L  F  G  F  A  E  Q  K         p.240  /176

          .         .         .         .      | 06  .         .    g.22116
 CAGCTGCTGGAGGTGGAACTCTACGCAGACTATAGAGAGAACTCG | TACGTGCCGACCACT    c.780
 Q  L  L  E  V  E  L  Y  A  D  Y  R  E  N  S   | Y  V  P  T  T      p.260  /196

          .         .         .         .         .         .       g.22176
 GGAGCGATCATTGAGATCCACAGCAAGCGCATCCAGCTGTATGGAGCCTACCTCCGCATC       c.840
 G  A  I  I  E  I  H  S  K  R  I  Q  L  Y  G  A  Y  L  R  I         p.280  /216

          .         .    | 07    .         .         .         .    g.23190
 CACGCGCACTTCACTGGGCTCAG | ATACCTGCTATACAACTTCCCGATGACCTGCGCCTTC    c.900
 H  A  H  F  T  G  L  R  |  Y  L  L  Y  N  F  P  M  T  C  A  F      p.300  /236
                         ^ alternatively spliced exon (transcript variant-3)

          .         .         .         .         .         .       g.23250
 ATAGGTGTTGCCAGCAACTTCACCTTCCTCAGCGTCATCGTGCTCTTCAGCTACATGCAG       c.960
 I  G  V  A  S  N  F  T  F  L  S  V  I  V  L  F  S  Y  M  Q         p.320  /256

          .         .         .         .      | 08  .         .    g.23448
 TGGGTGTGGGGGGGCATCTGGCCCCGACACCGCTTCTCTTTGCAG | GTTAACATCCGAAAA    c.1020
 W  V  W  G  G  I  W  P  R  H  R  F  S  L  Q   | V  N  I  R  K      p.340  /276
                                                 ^ transcript variant-3 uses a shifted reading frame

          .         .         .         .         .   | 09     .    g.23715
 AGAGACAATTCCCGGAAGGAAGTCCAACGAAGGATCTCTGCTCATCAGCCAG | GGCCTGAA    c.1080
 R  D  N  S  R  K  E  V  Q  R  R  I  S  A  H  Q  P  G |   P  E      p.360  /296

          .         .         .         .         .         .       g.23775
 GGCCAGGAGGAGTCAACTCCGCAATCAGATGTTACAGAGGATGGTGAGAGCCCTGAAGAT       c.1140
 G  Q  E  E  S  T  P  Q  S  D  V  T  E  D  G  E  S  P  E  D         p.380  /316

          .    | 10    .         .         .         .         .    g.23929
 CCCTCAGGGACAG | AGGGTCAGCTGTCCGAGGAGGAGAAACCAGATCAGCAGCCCCTGAGC    c.1200
 P  S  G  T  E |   G  Q  L  S  E  E  E  K  P  D  Q  Q  P  L  S      p.400  /336

          .         .         .     | 11   .         .         .    g.24079
 GGAGAAGAGGAGCTAGAGCCTGAGGCCAGTGATG | GTTCAGGCTCCTGGGAAGATGCAGCT    c.1260
 G  E  E  E  L  E  P  E  A  S  D  G |   S  G  S  W  E  D  A  A      p.420  /356

          .         .         .         .         .         .       g.24139
 TTGCTGACGGAGGCCAACCTGCCTGCTCCTGCTCCTGCTTCTGCTTCTGCCCCTGTCCTA       c.1320
 L  L  T  E  A  N  L  P  A  P  A  P  A  S  A  S  A  P  V  L         p.440  /376

          .         .         .         .         .         .       g.24199
 GAGACTCTGGGCAGCTCTGAACCTGCTGGGGGTGCTCTCCGACAGCGCCCCACCTGCTCT       c.1380
 E  T  L  G  S  S  E  P  A  G  G  A  L  R  Q  R  P  T  C  S         p.460  /396

                                                                    g.24208
 AGTTCCTGA                                                          c.1389
 S  S  X                                                            p.462  /398

          .         .         .         .         .         .       g.24268
 agaaaaggggcagactcctcacattccagcactttcccacctgactcctctcccctcgtt       c.*60

          .         .         .         .                           g.24313
 tttccttcaataaactattttgtgtcagcttcttccttgactctg                      c.*105

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Berardinelli-Seip congenital lipodystrophy 2 (seipin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVD v.2.0 Build 33
2004-2012 Leiden University Medical Center