Berardinelli-Seip congenital lipodystrophy 2 (seipin) (BSCL2) - 1491 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)

contains alternative promoter/exon 1b (transcript variants 2 and 3)


         .         .         .         .         .         .  g.7526
gtaggggcccttgtggggacagtcagcagaaatatactggaaataggtgggctggcgtga  c.87+60

         .         .         .         .         .         .  g.7586
agggggcggggggatggattggttttaagaatttcattcattttgaatagattacttccc  c.87+120

         .         .         .         .         .         .  g.7646
acgcccgcagcagtgtgcaaagatgtacacaacactggccttgcctctgaaggactttat  c.87+180

         .         .         .         .         .         .  g.7706
ctggggtgattagacgtctacaaaatagaagactgccaaaagctagtctagataatgtgc  c.87+240

         .         .         .         .         .         .  g.7766
tgtggggactctgagggagagtgtatccagttagggtcagaggaggtccacaatgctacc  c.87+300

         .         .         .         .         .         .  g.7826
acgctgggaacagggcactaatctgcctgcgcaacaacgcaagaggcccaggttgccgca  c.87+360

         .         .         .         .         .         .  g.7886
aactgcaacatgctctaggcgaatgcccccgccttagatgcctacaggtcctaggagctg  c.87+420

         .         .         .         .         .         .  g.7946
tgggcgataaaaatcagcgccagctggatgaccgcctcactcggccgcttcgcgggtgaa  c.87+480

         .         .         .         .         .         .  g.8006
atggcctgtggtgaaggtgtgcacggagggctgtgattgcagtctcaagggagagccgag  c.87+540

         .         .         .         .         .         .  g.8066
cggaggctgcagtcagcgcatcccctggggcacatcttggggcctgcagggaggcaggcg  c.87+600

         .         .         .         .         .         .  g.8126
tctttcccctttggtcacggtaaccggagggaaacctgccgcagagagagccagtggcga  c.87+660

         .         .         .         .         .         .  g.8186
gcgcaaggagacagcgacctcgcagctcgggaaggctccgccccgtcccgccccgccccg  c.87+720

         .         .        g.8212
ccgtgctggaccccgccctgggctga  c.87+746

--------------------- middle of intron ---------------------
                         g.8213         .         .           g.8237
                         c.88-745  agccccgcctcccacggctacaaaa  c.88-721

.         .         .  /         .         .         .           g.8297
gcggccggcggagaggggcggg / acttccccgggagccggaagtcccgtctcacggttgcc  c.88-661
                       ^  alternative promoter/exon 1b (transcript variants 2 and 3)

.         .         .         .         .         .           g.8357
ctggcagcgcgcgaggctggtgagtcggcagccctgtggcagccggcgggctggtttcca  c.88-601


.         .     |      .         .         .         .           g.8417
tggttgcacgattag | gtaggggctccgggcgctttgcccacccccgagctggaggggact  c.88-541


.         .         .         .         .         .           g.8477
ggcgggaagcggcggttggctgcagggcgctccgccgggcgtggggtgtagccgtgtcgg  c.88-481

.         .         .         .         .         .           g.8537
tgagcgagctctgctcgaggcggagaggagaaactcgggaagcaattgtggctactctaa  c.88-421

.         .         .         .         .         .           g.8597
ggctactggtttcgagtcaggccgtgcgaccttaggcaagtcgcacattctctccgtgca  c.88-361

.         .         .         .         .         .           g.8657
gctgcctagcagtgtggattcagtatcaccgtgtgtgtaaagctctttctaagaatcgta  c.88-301

.         .         .         .         .         .           g.8717
aggtgcttattctttgttatatagctgtgaatgagaatcaaggtggtttgtcccagcatc  c.88-241

.         .         .         .         .         .           g.8777
aaatgactggagaaggaattccactgaggagatttagcactgggcgggagggaacacagt  c.88-181

.         .         .         .         .         .           g.8837
ggaggaaagggaaggggtaattggcagagtggcacaatcatttggagaaaggccatatat  c.88-121

.         .         .         .         .         .           g.8897
atgaaacaatgactttgctatcctgctatctctcgttcctcaaagccagtccagtaagct  c.88-61

.         .         .         .         .         .           g.8957
gttttgtccccacctccctggggaaaggagtcactcttttccctcaccctctctttccag  c.88-1


Powered by LOVD v.2.0 Build 33
2004-2012 Leiden University Medical Center