Lamin A/C (LMNA) - coding DNA reference sequence

(used for mutation description)

(last modified April 5, 2010)


This file was created to facilitate the description of sequence variants in the LMNA gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008692.1, covering LMNA transcript variant 1 (NM_170707.2).  Lamin-C is encoded by transcript variant 2, terminating in intron 10 (NM_005572.3). Transcript variant 3 (NM_170708.2) skips exon 10.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                                                                    g.5009
                                                    aggaggacc       c.-241

 .         .         .         .         .         .                g.5069
 tattagagcctttgccccggcgtcggtgactcagtgttcgcgggagcgccgcacctacac       c.-181

 .         .         .         .         .         .                g.5129
 cagccaacccagatcccgaggtccgacagcgcccggcccagatccccacgcctgccagga       c.-121

 .         .         .         .         .         .                g.5189
 gcaagccgagagccagccggccggcgcactccgactccgagcagtctctgtccttcgacc       c.-61

 .         .         .         .         .         .                g.5249
 cgagccccgcgccctttccgggacccctgccccgcgggcagcgctgccaacctgccggcc       c.-1

          .         .         .         .         .         .       g.5309
 ATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCG       c.60
 M  E  T  P  S  Q  R  R  A  T  R  S  G  A  Q  A  S  S  T  P         p.20

          .         .         .         .         .         .       g.5369
 CTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGAT       c.120
 L  S  P  T  R  I  T  R  L  Q  E  K  E  D  L  Q  E  L  N  D         p.40

          .         .         .         .         .         .       g.5429
 CGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGC       c.180
 R  L  A  V  Y  I  D  R  V  R  S  L  E  T  E  N  A  G  L  R         p.60

          .         .         .         .         .         .       g.5489
 CTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCC       c.240
 L  R  I  T  E  S  E  E  V  V  S  R  E  V  S  G  I  K  A  A         p.80

          .         .         .         .         .         .       g.5549
 TACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCC       c.300
 Y  E  A  E  L  G  D  A  R  K  T  L  D  S  V  A  K  E  R  A         p.100

          .         .         .         .         .       | 02 .    g.20951
 CGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCG | CAAT    c.360
 R  L  Q  L  E  L  S  K  V  R  E  E  F  K  E  L  K  A  R  |  N      p.120

          .         .         .         .         .         .       g.21011
 ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTG       c.420
 T  K  K  E  G  D  L  I  A  A  Q  A  R  L  K  D  L  E  A  L         p.140

          .         .         .         .         .         .       g.21071
 CTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGC       c.480
 L  N  S  K  E  A  A  L  S  T  A  L  S  E  K  R  T  L  E  G         p.160

          .         .         .    | 03    .         .         .    g.24760
 GAGCTGCATGATCTGCGGGGCCAGGTGGCCAAG | CTTGAGGCAGCCCTAGGTGAGGCCAAG    c.540
 E  L  H  D  L  R  G  Q  V  A  K   | L  E  A  A  L  G  E  A  K      p.180

          .         .         .         .         .         .       g.24820
 AAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATG       c.600
 K  Q  L  Q  D  E  M  L  R  R  V  D  A  E  N  R  L  Q  T  M         p.200

          .         .         .          | 04        .         .    g.25156
 AAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAG | GAGCTGCGTGAGACCAAGCGC    c.660
 K  E  E  L  D  F  Q  K  N  I  Y  S  E   | E  L  R  E  T  K  R      p.220

          .         .         .         .         .         .       g.25216
 CGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGG       c.720
 R  H  E  T  R  L  V  E  I  D  N  G  K  Q  R  E  F  E  S  R         p.240

          .         .         .         .         .         .       g.25276
 CTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAG       c.780
 L  A  D  A  L  Q  E  L  R  A  Q  H  E  D  Q  V  E  Q  Y  K         p.260

          .         .         . | 05       .         .         .    g.25547
 AAGGAGCTGGAGAAGACTTATTCTGCCAAG | CTGGACAATGCCAGGCAGTCTGCTGAGAGG    c.840
 K  E  L  E  K  T  Y  S  A  K   | L  D  N  A  R  Q  S  A  E  R      p.280

          .         .         .         .         .         .       g.25607
 AACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGAC       c.900
 N  S  N  L  V  G  A  A  H  E  E  L  Q  Q  S  R  I  R  I  D         p.300

          .         .         .       | 06 .         .         .    g.26255
 AGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAG | CTGGCAGCCAAGGAGGCGAAGCTT    c.960
 S  L  S  A  Q  L  S  Q  L  Q  K  Q   | L  A  A  K  E  A  K  L      p.320

          .         .         .         .         .         .       g.26315
 CGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAA       c.1020
 R  D  L  E  D  S  L  A  R  E  R  D  T  S  R  R  L  L  A  E         p.340

          .         .         .         .         .         .       g.26375
 AAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAG       c.1080
 K  E  R  E  M  A  E  M  R  A  R  M  Q  Q  Q  L  D  E  Y  Q         p.360

          .         .         .         .         .         .       g.26435
 GAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTG       c.1140
 E  L  L  D  I  K  L  A  L  D  M  E  I  H  A  Y  R  K  L  L         p.380

          .        | 07.         .         .         .         .    g.26587
 GAGGGCGAGGAGGAGAG | GCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGC    c.1200
 E  G  E  E  E  R  |  L  R  L  S  P  S  P  T  S  Q  R  S  R  G      p.400

          .         .         .         .         .         .       g.26647
 CGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAA       c.1260
 R  A  S  S  H  S  S  Q  T  Q  G  G  G  S  V  T  K  K  R  K         p.420

          .         .         .         .         .         .       g.26707
 CTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTG       c.1320
 L  E  S  T  E  S  R  S  S  F  S  Q  H  A  R  T  S  G  R  V         p.440

          .         .         .         .         .         .       g.26767
 GCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAG       c.1380
 A  V  E  E  V  D  E  E  G  K  F  V  R  L  R  N  K  S  N  E         p.460

  | 08       .         .         .         .         .         .    g.27311
  | GACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACT    c.1440
  | D  Q  S  M  G  N  W  Q  I  K  R  Q  N  G  D  D  P  L  L  T      p.480

          .         .         .         .         | 09         .    g.27455
 TACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACG | ATCTGGGCTGCA    c.1500
 Y  R  F  P  P  K  F  T  L  K  A  G  Q  V  V  T   | I  W  A  A      p.500

          .         .         .         .         .         .       g.27515
 GGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGG       c.1560
 G  A  G  A  T  H  S  P  P  T  D  L  V  W  K  A  Q  N  T  W         p.520

          .         .         .         .         | 10         .    g.27996
 GGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAA | GAAGTGGCCATG    c.1620
 G  C  G  N  S  L  R  T  A  L  I  N  S  T  G  E   | E  V  A  M      p.540
                                                  ^  alternatively spliced

          .         .         .         .         .         .       g.28056
 CGCAAGCTGGTGCGCTCAGTGACTGTGGTTGAGGACGACGAGGATGAGGATGGAGATGAC       c.1680
 R  K  L  V  R  S  V  T  V  V  E  D  D  E  D  E  D  G  D  D         p.560

                      lamin C differs from this site downstream (see 11)
          .         | 11         .         .         .         .    g.28860
 CTGCTCCATCACCACCAC | GGCTCCCACTGCAGCAGCTCGGGGGACCCCGCTGAGTACAAC    c.1740
 L  L  H  H  H  H   | G  S  H  C  S  S  S  G  D  P  A  E  Y  N      p.580

          .         .         .         .         .         .       g.28920
 CTGCGCTCGCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGACAAGGCATCTGCC       c.1800
 L  R  S  R  T  V  L  C  G  T  C  G  Q  P  A  D  K  A  S  A         p.600

          .         .         .         .         .         .       g.28980
 AGCGGCTCAGGAGCCCAGGTGGGCGGACCCATCTCCTCTGGCTCTTCTGCCTCCAGTGTC       c.1860
 S  G  S  G  A  Q  V  G  G  P  I  S  S  G  S  S  A  S  S  V         p.620

          .         .         .         .         .         .       g.29040
 ACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAAT       c.1920
 T  V  T  R  S  Y  R  S  V  G  G  S  G  G  G  S  F  G  D  N         p.640

          .         .         .         .         | 12         .    g.29422
 CTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGCCCCCGAACCCAG | AGCCCCCAGAAC    c.1980
 L  V  T  R  S  Y  L  L  G  N  S  S  P  R  T  Q   | S  P  Q  N      p.660

          .                                                         g.29437
 TGCAGCATCATGTAA                                                    c.1995
 C  S  I  M  X                                                      p.664

          .         .         .         .         .         .       g.29497
 tctgggacctgccaggcaggggtgggggtggaggcttcctgcgtcctcctcacctcatgc       c.*60

          .         .         .         .         .         .       g.29557
 ccaccccctgccctgcacgtcatgggagggggcttgaagccaaagaaaaataaccctttg       c.*120

          .         .         .         .         .         .       g.29617
 gtttttttcttctgtatttttttttctaagagaagttattttctacagtggttttatact       c.*180

          .         .         .         .         .         .       g.29677
 gaaggaaaaacacaagcaaaaaaaaaaaaaagcatctatctcatctatctcaatcctaat       c.*240

          .         .         .         .         .         .       g.29737
 ttctcctcccttccttttccctgcttccaggaaactccacatctgccttaaaaccaaaga       c.*300

          .         .         .         .         .         .       g.29797
 gggcttcctctagaagccaagggaaaggggtgcttttatagaggctagcttctgcttttc       c.*360

          .         .         .         .         .         .       g.29857
 tgccctggctgctgcccccaccccggggaccctgtgacatggtgcctgagaggcaggcat       c.*420

          .         .         .         .         .         .       g.29917
 agaggcttctccgccagcctcctctggacggcaggctcactgccaggccagcctccgaga       c.*480

          .         .         .         .         .         .       g.29977
 gggagagagagagagagaggacagcttgagccgggcccctgggcttggcctgctgtgatt       c.*540

          .         .         .         .         .         .       g.30037
 ccactacacctggctgaggttcctctgcctgccccgcccccagtccccacccctgccccc       c.*600

          .         .         .         .         .         .       g.30097
 agccccggggtgagtccattctcccaggtaccagctgcgcttgcttttctgtattttatt       c.*660

          .         .         .         .         .         .       g.30157
 tagacaagagatgggaatgaggtgggaggtggaagaagggagaagaaaggtgagtttgag       c.*720

          .         .         .         .         .         .       g.30217
 ctgccttccctagctttagaccctgggtgggctctgtgcagtcactggaggttgaagcca       c.*780

          .         .         .         .         .         .       g.30277
 agtggggtgctgggaggagggagagggaggtcactggaaaggggagagcctgctggcacc       c.*840

          .         .         .         .         .         .       g.30337
 caccgtggaggaggaaggcaagagggggtggaggggtgtggcagtggttttggcaaacgc       c.*900

          .         .         .         .         .         .       g.30397
 taaagagcccttgcctccccatttcccatctgcaccccttctctcctccccaaatcaata       c.*960

          .         .                                               g.30418
 cactagttgtttctacccctg                                              c.*981

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Lamin A/C protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center