Lamin A/C (LMNA) - 744 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


Transcripts terminating in this intron encode the LMNA lamin-C isoform (NM_005572.3).


exon 10a .         .         .         .         .         .  g.28134
gtgagtggtagccgccgctgaggccgagcctgcactggggccacccagccaggcctgggg  c.1698+60
V  S  G  S  R  R  *                                           p.566+6

         .         .         .         .         .         .  g.28194
gcagcctctccccagcctccccgtgccaaaaatcttttcattaaagaatgttttggaact  c.1698+120

    |       .         .         .         .         .         .  g.28254
tta | ctcgctggcctggcctttcttctctctcctccctataccttgaacagggaacccagg  c.1698+180
  ^ polyA addition site lamin-C transcripts

         .         .         .         .         .         .  g.28314
tgtctgggtgccctactctggtaaggaagggagtgggaactttctgatgccatggaatat  c.1698+240

         .         .         .         .         .         .  g.28374
tcctgtgggagcagtggacaagggtctggatttgtcttctgggaaagggaggggaggaca  c.1698+300

         .         .         .         .         .         .  g.28434
gacgtggggcatgcccgccctgcctctctcccccattcttgttgcatgcatatcctctca  c.1698+360

         .    g.28446
tttccctcattt  c.1698+372

--------------------- middle of intron ---------------------
                                    g.28447       .           g.28458
                                    c.1699-372  ttcctgcaagaa  c.1699-361

.         .         .         .         .         .           g.28518
tgttctctctcattcctgaccgcccctccactccaattaatagtgcatgcctgctgccct  c.1699-301

.         .         .         .         .         .           g.28578
acaagcttgctcccgttctctcttcttttcctcttaagctcagagtagctagaacagagt  c.1699-241

.         .         .         .         .         .           g.28638
cagagtcactgctctggttctctgtccccaagtcttcctgagccttctccccttttatgt  c.1699-181

.         .         .         .         .         .           g.28698
cttccctctcctcctccgggcccctagcctcccaaacccccattgcccgctggctccttg  c.1699-121

.         .         .         .         .         .           g.28758
ggcacagaaccacaccttcctgcctggcggctgggagcctgcaggagcctggagcctggt  c.1699-61

.         .         .         .         .         .           g.28818
tgggcctgagtggtcagtcccagactcgccgtcccgcctgagccttgtctcccttcccag  c.1699-1


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center