Leiden Muscular Dystrophy pages

Dystrophin (DMD) cDNA Reference Sequence

(last modified  November 25, 2002)


Important notice

Please note that this DMD cDNA Reference Sequence, as of January 1 2003, will be replaced for a new cDNA Reference Sequence.


The dystrophin cDNA Reference Sequence is based on GenBank M18533 (Koenig et al.). The bases 5' of nucleotide 1 are derived from the Dp427m promoter/exon 1 sequence (GenBank M32058) and the mapping of the Dp427m transcription initiation site as reported by Klamut et al. The 'TCCC' sequence (bp 6-9 of M18533) is a sequencing or cloning error since the genomic sequence reads 'CAC' (Koenig et al.). Other modifications include 4614T>A (Leu1469Gln) and 5738A>C (Ar1844Arg).

Most mutations published to date have used M18533 (GenBank) as the cDNA Reference Sequence and we will do the same. Please note that M18533 does not contain the full Dp427m mRNA sequence; bases 1-8 should be replaced by 44 other nucleotides (see GenBank NM_004006.1). Consequently, in the numbering used here, the ATG-codon is at position 209 (M18533), which is at 245 in the full-length Dp427m mRNA (GenBank NM_004006.1).


Legend:
nucleotide numbering (as in M18533) is indicated at the left of the sequence, amino acid numbering at the right, counting the translation initiating Methionine as +1. The top reading frame (shown in one-letter amino acid code) is the open reading frame of dystrophin. The exon numbers are indicated on the extreme left with the size of the hybridizing HindIII-fragment (in kb) given on the first occurrence of the exon. The position of intronic sequences is indicated by a vertical line, splitting the two flanking exons.

                                   .         .         .         .
                                 ggcATCAGTTACTGTGTTGACTCACTCAGTGTT

            CAC.         .         .         .         .         .
    1 GGGATtcccTCACTTTCCCCCTACAggactcagatctgggaggcaattaccttcggagaa
 3.1
1
               .         .         .         .         .         .
   61 AAACGAATAGGAAAAACTGAAGTGTTACTTTTTTTAAAGCTGCTGAAGTTTGTTGGTTTC
1
               .         .         .         .         .         .
  121 TCATTGTTTTTAAGCCTACTGGAGCAATAAAGTTTGAAGAACTTTTACCAGGTTTTTTTT
1
               .         .         .         .         .            .
  181 ATCGCTGCCTTGATATACACTTTTCAAAATGCTTTGGTGGGAAGAAGTAGAGGACTGTT | A
                                  M  L  W  W  E  E  V  E  D  C  Y |   -11
1                                  C  F  G  G  K  K  *  R  T  V   | M
                                    A  L  V  G  R  S  R  G  L  L  |
               .         .         .         .         .         .
  241 TGAAAGAGAAGATGTTCAAAAGAAAACATTCACAAAATGGGTAAATGCACAATTTTCTAA
 3.3   E  R  E  D  V  Q  K  K  T  F  T  K  W  V  N  A  Q  F  S  K  -31
2       K  E  K  M  F  K  R  K  H  S  Q  N  G  *  M  H  N  F  L  S
      *  K  R  R  C  S  K  E  N  I  H  K  M  G  K  C  T  I  F  *
                  .         .         .         .         .         .
  301 G | TTTGGGAAGCAGCATATTGAGAACCTCTTCAGTGACCTACAGGATGGGAGGCGCCTCCT
        | F  G  K  Q  H  I  E  N  L  F  S  D  L  Q  D  G  R  R  L  L  -51
2       |  L  G  S  S  I  L  R  T  S  S  V  T  Y  R  M  G  G  A  S  *
      V |   W  E  A  A  Y  *  E  P  L  Q  *  P  T  G  W  E  A  P  P
               .         .         .            .         .         .
  361 AGACCTCCTCGAAGGCCTGACAGGGCAAAAACTG | CCAAAAGAAAAAGGATCCACAAGAGT
 4.1   D  L  L  E  G  L  T  G  Q  K  L   | P  K  E  K  G  S  T  R  V  -71
3       T  S  S  K  A  *  Q  G  K  N  C  |  Q  K  K  K  D  P  Q  E  F
      R  P  P  R  R  P  D  R  A  K  T  A |   K  R  K  R  I  H  K  S
               .         .         .         .         .            .
  421 TCATGCCCTGAACAATGTCAACAAGGCACTGCGGGTTTTGCAGAACAATAAT | GTTGATTT
 8.2   H  A  L  N  N  V  N  K  A  L  R  V  L  Q  N  N  N   | V  D  L  -91
4       M  P  *  T  M  S  T  R  H  C  G  F  C  R  T  I  M  |  L  I  *
      S  C  P  E  Q  C  Q  Q  G  T  A  G  F  A  E  Q  *  C |   *  F
               .         .         .         .         .         .
  481 AGTGAATATTGGAAGTACTGACATCGTAGATGGAAATCATAAACTGACTCTTGGTTTGAT
 2.9   V  N  I  G  S  T  D  I  V  D  G  N  H  K  L  T  L  G  L  I  -111
5       *  I  L  E  V  L  T  S  *  M  E  I  I  N  *  L  L  V  *  F
      S  E  Y  W  K  Y  *  H  R  R  W  K  S  *  T  D  S  W  F  D
               .         .            .         .         .         .
  541 TTGGAATATAATCCTCCACTGGCAG | GTCAAAAATGTAATGAAAAATATCATGGCTGGATT
       W  N  I  I  L  H  W  Q   | V  K  N  V  M  K  N  I  M  A  G  L  -131
5       G  I  *  S  S  T  G  R  |  S  K  M  *  *  K  I  S  W  L  D  C
      L  E  Y  N  P  P  L  A  G |   Q  K  C  N  E  K  Y  H  G  W  I
               .         .         .         .         .         .
  601 GCAACAAACCAACAGTGAAAAGATTCTCCTGAGCTGGGTCCGACAATCAACTCGTAATTA
 7.8   Q  Q  T  N  S  E  K  I  L  L  S  W  V  R  Q  S  T  R  N  Y  -151
6       N  K  P  T  V  K  R  F  S  *  A  G  S  D  N  Q  L  V  I  I
      A  T  N  Q  Q  *  K  D  S  P  E  L  G  P  T  I  N  S  *  L
               .         .         .         .         .         .
  661 TCCACAGGTTAATGTAATCAACTTCACCACCAGCTGGTCTGATGGCCTGGCTTTGAATGC
       P  Q  V  N  V  I  N  F  T  T  S  W  S  D  G  L  A  L  N  A  -171
6       H  R  L  M  *  S  T  S  P  P  A  G  L  M  A  W  L  *  M  L
      S  T  G  *  C  N  Q  L  H  H  Q  L  V  *  W  P  G  F  E  C
               .            .         .         .         .         .
  721 TCTCATCCATAGTCATAG | GCCAGACCTATTTGACTGGAATAGTGTGGTTTGCCAGCAGTC
       L  I  H  S  H  R  |  P  D  L  F  D  W  N  S  V  V  C  Q  Q  S  -191
6       S  S  I  V  I  G |   Q  T  Y  L  T  G  I  V  W  F  A  S  S  Q
      S  H  P  *  S  *   | A  R  P  I  *  L  E  *  C  G  L  P  A  V
               .         .         .         .         .         .
  781 AGCCACACAACGACTGGAACATGCATTCAACATCGCCAGATATCAATTAGGCATAGAGAA
 4.4   A  T  Q  R  L  E  H  A  F  N  I  A  R  Y  Q  L  G  I  E  K  -211
7       P  H  N  D  W  N  M  H  S  T  S  P  D  I  N  *  A  *  R  N
      S  H  T  T  T  G  T  C  I  Q  H  R  Q  I  S  I  R  H  R  E
               .            .         .         .         .         .
  841 ACTACTCGATCCTGAAG | ATGTTGATACCACCTATCCAGATAAGAAGTCCATCTTAATGTA
       L  L  D  P  E  D |   V  D  T  T  Y  P  D  K  K  S  I  L  M  Y  -231
7       Y  S  I  L  K   | M  L  I  P  P  I  Q  I  R  S  P  S  *  C  T
      T  T  R  S  *  R  |  C  *  Y  H  L  S  R  *  E  V  H  L  N  V
               .         .         .         .         .         .
  901 CATCACATCACTCTTCCAAGTTTTGCCTCAACAAGTGAGCATTGAAGCCATCCAGGAAGT
 7.2   I  T  S  L  F  Q  V  L  P  Q  Q  V  S  I  E  A  I  Q  E  V  -251
8       S  H  H  S  S  K  F  C  L  N  K  *  A  L  K  P  S  R  K  W
      H  H  I  T  L  P  S  F  A  S  T  S  E  H  *  S  H  P  G  S
               .         .         .         .         .         .
  961 GGAAATGTTGCCAAGGCCACCTAAAGTGACTAAAGAAGAACATTTTCAGTTACATCATCA
       E  M  L  P  R  P  P  K  V  T  K  E  E  H  F  Q  L  H  H  Q  -271
8       K  C  C  Q  G  H  L  K  *  L  K  K  N  I  F  S  Y  I  I  K
      G  N  V  A  K  A  T  *  S  D  *  R  R  T  F  S  V  T  S  S
               .            .         .         .         .         .
 1021 AATGCACTATTCTCAACAG | ATCACGGTCAGTCTAGCACAGGGATATGAGAGAACTTCTTC
       M  H  Y  S  Q  Q   | I  T  V  S  L  A  Q  G  Y  E  R  T  S  S  -291
8       C  T  I  L  N  R  |  S  R  S  V  *  H  R  D  M  R  E  L  L  P
      N  A  L  F  S  T  D |   H  G  Q  S  S  T  G  I  *  E  N  F  F
               .         .         .         .         .         .
 1081 CCCTAAGCCTCGATTCAAGAGCTATGCCTACACACAGGCTGCTTATGTCACCACCTCTGA
 7.2   P  K  P  R  F  K  S  Y  A  Y  T  Q  A  A  Y  V  T  T  S  D  -311
9       L  S  L  D  S  R  A  M  P  T  H  R  L  L  M  S  P  P  L  T
      P  *  A  S  I  Q  E  L  C  L  H  T  G  C  L  C  H  H  L  *
               .         .            .         .         .         .
 1141 CCCTACACGGAGCCCATTTCCTTCACAG | CATTTGGAAGCTCCTGAAGACAAGTCATTTGG
       P  T  R  S  P  F  P  S  Q   | H  L  E  A  P  E  D  K  S  F  G  -331
9       L  H  G  A  H  F  L  H  S  |  I  W  K  L  L  K  T  S  H  L  A
      P  Y  T  E  P  I  S  F  T  A |   F  G  S  S  *  R  Q  V  I  W
               .         .         .         .         .         .
 1201 CAGTTCATTGATGGAGAGTGAAGTAAACCTGGACCGTTATCAAACAGCTTTAGAAGAAGT   R01
 11    S  S  L  M  E  S  E  V  N  L  D  R  Y  Q  T  A  L  E  E  V  -351
10      V  H  *  W  R  V  K  *  T  W  T  V  I  K  Q  L  *  K  K  Y
      Q  F  I  D  G  E  *  S  K  P  G  P  L  S  N  S  F  R  R  S
               .         .         .         .         .         .
 1261 ATTATCGTGGCTTCTTTCTGCTGAGGACACATTGCAAGCACAAGGAGAGATTTCTAATGA
       L  S  W  L  L  S  A  E  D  T  L  Q  A  Q  G  E  I  S  N  D  -371
10      Y  R  G  F  F  L  L  R  T  H  C  K  H  K  E  R  F  L  M  M
      I  I  V  A  S  F  C  *  G  H  I  A  S  T  R  R  D  F  *  *
               .         .         .            .         .         .
 1321 TGTGGAAGTGGTGAAAGACCAGTTTCATACTCATGAG | GGGTACATGATGGATTTGACAGC
       V  E  V  V  K  D  Q  F  H  T  H  E   | G  Y  M  M  D  L  T  A  -391
10      W  K  W  *  K  T  S  F  I  L  M  R  |  G  T  *  W  I  *  Q  P
      C  G  S  G  E  R  P  V  S  Y  S  *  G |   V  H  D  G  F  D  S
               .         .         .         .         .         .
 1381 CCATCAGGGCCGGGTTGGTAATATTCTACAATTGGGAAGTAAGCTGATTGGAACAGGAAA
 11    H  Q  G  R  V  G  N  I  L  Q  L  G  S  K  L  I  G  T  G  K  -411
11      I  R  A  G  L  V  I  F  Y  N  W  E  V  S  *  L  E  Q  E  N
      P  S  G  P  G  W  *  Y  S  T  I  G  K  *  A  D  W  N  R  K
               .         .         .         .         .         .
 1441 ATTATCAGAAGATGAAGAAACTGAAGTACAAGAGCAGATGAATCTCCTAAATTCAAGATG
       L  S  E  D  E  E  T  E  V  Q  E  Q  M  N  L  L  N  S  R  W  -431
11      Y  Q  K  M  K  K  L  K  Y  K  S  R  *  I  S  *  I  Q  D  G
      I  I  R  R  *  R  N  *  S  T  R  A  D  E  S  P  K  F  K  M
               .         .         .            .         .         .
 1501 GGAATGCCTCAGGGTAGCTAGCATGGAAAAACAAAGCAA | TTTACATAGAGTTTTAATGGA   R02
       E  C  L  R  V  A  S  M  E  K  Q  S  N  |  L  H  R  V  L  M  D  -451
11      N  A  S  G  *  L  A  W  K  N  K  A  I |   Y  I  E  F  *  W  I
      G  M  P  Q  G  S  *  H  G  K  T  K  Q   | F  T  *  S  F  N  G
               .         .         .         .         .         .
 1561 TCTCCAGAATCAGAAACTGAAAGAGTTGAATGACTGGCTAACAAAAACAGAAGAAAGAAC
 3.9   L  Q  N  Q  K  L  K  E  L  N  D  W  L  T  K  T  E  E  R  T  -471
12      S  R  I  R  N  *  K  S  *  M  T  G  *  Q  K  Q  K  K  E  Q
      S  P  E  S  E  T  E  R  V  E  *  L  A  N  K  N  R  R  K  N
               .         .         .         .         .         .
 1621 AAGGAAAATGGAGGAAGAGCCTCTTGGACCTGATCTTGAAGACCTAAAACGCCAAGTACA
       R  K  M  E  E  E  P  L  G  P  D  L  E  D  L  K  R  Q  V  Q  -491
12      G  K  W  R  K  S  L  L  D  L  I  L  K  T  *  N  A  K  Y  N
      K  E  N  G  G  R  A  S  W  T  *  S  *  R  P  K  T  P  S  T
                  .         .         .         .         .         .
 1681 ACAACATAAG | GTGCTTCAAGAAGATCTAGAACAAGAACAAGTCAGGGTCAATTCTCTCAC
       Q  H  K   | V  L  Q  E  D  L  E  Q  E  Q  V  R  V  N  S  L  T  -511
12      N  I  R  |  C  F  K  K  I  *  N  K  N  K  S  G  S  I  L  S  L
      T  T  *  G |   A  S  R  R  S  R  T  R  T  S  Q  G  Q  F  S  H
               .         .         .         .         .         .
 1741 TCACATGGTGGTGGTAGTTGATGAATCTAGTGGAGATCACGCAACTGCTGCTTTGGAAGA
 6.4   H  M  V  V  V  V  D  E  S  S  G  D  H  A  T  A  A  L  E  E  -531
13      T  W  W  W  *  L  M  N  L  V  E  I  T  Q  L  L  L  W  K  N
      S  H  G  G  G  S  *  *  I  *  W  R  S  R  N  C  C  F  G  R
                  .         .         .         .         .         .
 1801 ACAACTTAAG | GTATTGGGAGATCGATGGGCAAACATCTGTAGATGGACAGAAGACCGCTG
       Q  L  K   | V  L  G  D  R  W  A  N  I  C  R  W  T  E  D  R  W  -551
13      N  L  R  |  Y  W  E  I  D  G  Q  T  S  V  D  G  Q  K  T  A  G
      T  T  *  G |   I  G  R  S  M  G  K  H  L  *  M  D  R  R  P  L
               .         .         .         .         .            .
 1861 GGTTCTTTTACAAGACATCCTTCTCAAATGGCAACGTCTTACTGAAGAACAG | TGCCTTTT   R03
 2.6   V  L  L  Q  D  I  L  L  K  W  Q  R  L  T  E  E  Q   | C  L  F  -571
14      F  F  Y  K  T  S  F  S  N  G  N  V  L  L  K  N  S  |  A  F  L
      G  S  F  T  R  H  P  S  Q  M  A  T  S  Y  *  R  T  V |   P  F
               .         .         .         .         .         .
 1921 TAGTGCATGGCTTTCAGAAAAAGAAGATGCAGTGAACAAGATTCACACAACTGGCTTTAA
 2.6   S  A  W  L  S  E  K  E  D  A  V  N  K  I  H  T  T  G  F  K  -591
15      V  H  G  F  Q  K  K  K  M  Q  *  T  R  F  T  Q  L  A  L  K
      *  C  M  A  F  R  K  R  R  C  S  E  Q  D  S  H  N  W  L  *
               .         .         .         .            .         .
 1981 AGATCAAAATGAAATGTTATCAAGTCTTCAAAAACTGGCC | GTTTTAAAAGCGGATCTAGA
       D  Q  N  E  M  L  S  S  L  Q  K  L  A   | V  L  K  A  D  L  E  -611
15      I  K  M  K  C  Y  Q  V  F  K  N  W  P  |  F  *  K  R  I  *  K
      R  S  K  *  N  V  I  K  S  S  K  T  G  R |   F  K  S  G  S  R
               .         .         .         .         .         .
 2041 AAAGAAAAAGCAATCCATGGGCAAACTGTATTCACTCAAACAAGATCTTCTTTCAACACT  hinge 1
 6.0   K  K  K  Q  S  M  G  K  L  Y  S  L  K  Q  D  L  L  S  T  L  -631
16      R  K  S  N  P  W  A  N  C  I  H  S  N  K  I  F  F  Q  H  *
      K  E  K  A  I  H  G  Q  T  V  F  T  Q  T  R  S  S  F  N  T
               .         .         .         .         .         .
 2101 GAAGAATAAGTCAGTGACCCAGAAGACGGAAGCATGGCTGGATAACTTTGCCCGGTGTTG
       K  N  K  S  V  T  Q  K  T  E  A  W  L  D  N  F  A  R  C  W  -651
16      R  I  S  Q  *  P  R  R  R  K  H  G  W  I  T  L  P  G  V  G
      E  E  *  V  S  D  P  E  D  G  S  M  A  G  *  L  C  P  V  L
               .         .         .         .            .         .
 2161 GGATAATTTAGTCCAAAAACTTGAAAAGAGTACAGCACAG | ATTTCACAGGCTGTCACCAC   R04
       D  N  L  V  Q  K  L  E  K  S  T  A  Q   | I  S  Q  A  V  T  T  -671
16      I  I  *  S  K  N  L  K  R  V  Q  H  R  |  F  H  R  L  S  P  P
      G  *  F  S  P  K  T  *  K  E  Y  S  T  D |   F  T  G  C  H  H
               .         .         .         .         .         .
 2221 CACTCAGCCATCACTAACACAGACAACTGTAATGGAAACAGTAACTACGGTGACCACAAG
 1.8   T  Q  P  S  L  T  Q  T  T  V  M  E  T  V  T  T  V  T  T  R  -691
17      L  S  H  H  *  H  R  Q  L  *  W  K  Q  *  L  R  *  P  Q  G
      H  S  A  I  T  N  T  D  N  C  N  G  N  S  N  Y  G  D  H  K
               .         .         .         .         .         .
 2281 GGAACAGATCCTGGTAAAGCATGCTCAAGAGGAACTTCCACCACCACCTCCCCAAAAGAA
       E  Q  I  L  V  K  H  A  Q  E  E  L  P  P  P  P  P  Q  K  K  -711
17      N  R  S  W  *  S  M  L  K  R  N  F  H  H  H  L  P  K  R  R
      G  T  D  P  G  K  A  C  S  R  G  T  S  T  T  T  S  P  K  E
               .         .         .            .         .         .
 2341 GAGGCAGATTACTGTGGATTCTGAAATTAGGAAAAG | GTTGGATGTTGATATAACTGAACT
       R  Q  I  T  V  D  S  E  I  R  K  R  |  L  D  V  D  I  T  E  L  -731
17      G  R  L  L  W  I  L  K  L  G  K  G |   W  M  L  I  *  L  N  F
      E  A  D  Y  C  G  F  *  N  *  E  K   | V  G  C  *  Y  N  *  T
               .         .         .         .         .         .
 2401 TCACAGCTGGATTACTCGCTCAGAAGCTGTGTTGCAGAGTCCTGAATTTGCAATCTTTCG
 12    H  S  W  I  T  R  S  E  A  V  L  Q  S  P  E  F  A  I  F  R  -751
18      T  A  G  L  L  A  Q  K  L  C  C  R  V  L  N  L  Q  S  F  G
      S  Q  L  D  Y  S  L  R  S  C  V  A  E  S  *  I  C  N  L  S
               .         .         .         .            .         .
 2461 GAAGGAAGGCAACTTCTCAGACTTAAAAGAAAAAGTCAAT | GCCATAGAGCGAGAAAAAGC
       K  E  G  N  F  S  D  L  K  E  K  V  N   | A  I  E  R  E  K  A  -771
18      R  K  A  T  S  Q  T  *  K  K  K  S  M  |  P  *  S  E  K  K  L
      E  G  R  Q  L  L  R  L  K  R  K  S  Q  C |   H  R  A  R  K  S
               .         .         .         .         .         .
 2521 TGAGAAGTTCAGAAAACTGCAAGATGCCAGCAGATCAGCTCAGGCCCTGGTGGAACAGAT
 3.0   E  K  F  R  K  L  Q  D  A  S  R  S  A  Q  A  L  V  E  Q  M  -791
19      R  S  S  E  N  C  K  M  P  A  D  Q  L  R  P  W  W  N  R  W
      *  E  V  Q  K  T  A  R  C  Q  Q  I  S  S  G  P  G  G  T  D
                  .         .         .         .         .         .
 2581 GGTGAATG | AGGGTGTTAATGCAGATAGCATCAAACAAGCCTCAGAACAACTGAACAGCCG
       V  N  E |   G  V  N  A  D  S  I  K  Q  A  S  E  Q  L  N  S  R  -811
19      *  M   | R  V  L  M  Q  I  A  S  N  K  P  Q  N  N  *  T  A  G
      G  E  *  |  G  C  *  C  R  *  H  Q  T  S  L  R  T  T  E  Q  P
               .         .         .         .         .         .
 2641 GTGGATCGAATTCTGCCAGTTGCTAAGTGAGAGACTTAACTGGCTGGAGTATCAGAACAA   R05
 7.6   W  I  E  F  C  Q  L  L  S  E  R  L  N  W  L  E  Y  Q  N  N  -831
20      G  S  N  S  A  S  C  *  V  R  D  L  T  G  W  S  I  R  T  T
      V  D  R  I  L  P  V  A  K  *  E  T  *  L  A  G  V  S  E  Q
               .         .         .         .         .         .
 2701 CATCATCGCTTTCTATAATCAGCTACAACAATTGGAGCAGATGACAACTACTGCTGAAAA
       I  I  A  F  Y  N  Q  L  Q  Q  L  E  Q  M  T  T  T  A  E  N  -851
20      S  S  L  S  I  I  S  Y  N  N  W  S  R  *  Q  L  L  L  K  T
      H  H  R  F  L  *  S  A  T  T  I  G  A  D  D  N  Y  C  *  K
               .         .         .         .         .         .
 2761 CTGGTTGAAAATCCAACCCACCACCCCATCAGAGCCAACAGCAATTAAAAGTCAGTTAAA
       W  L  K  I  Q  P  T  T  P  S  E  P  T  A  I  K  S  Q  L  K  -871
20      G  *  K  S  N  P  P  P  H  Q  S  Q  Q  Q  L  K  V  S  *  K
      L  V  E  N  P  T  H  H  P  I  R  A  N  S  N  *  K  S  V  K
               .            .         .         .         .         .
 2821 AATTTGTAAG | GATGAAGTCAACCGGCTATCAGGTCTTCAACCTCAAATTGAACGATTAAA
       I  C  K   | D  E  V  N  R  L  S  G  L  Q  P  Q  I  E  R  L  K  -891
20      F  V  R  |  M  K  S  T  G  Y  Q  V  F  N  L  K  L  N  D  *  K
      N  L  *  G |   *  S  Q  P  A  I  R  S  S  T  S  N  *  T  I  K
               .         .         .         .         .         .
 2881 AATTCAAAGCATAGCCCTGAAAGAGAAAGGACAAGGACCCATGTTCCTGGATGCAGACTT
 12    I  Q  S  I  A  L  K  E  K  G  Q  G  P  M  F  L  D  A  D  F  -911
21      F  K  A  *  P  *  K  R  K  D  K  D  P  C  S  W  M  Q  T  L
      N  S  K  H  S  P  E  R  E  R  T  R  T  H  V  P  G  C  R  L
               .         .         .         .         .         .
 2941 TGTGGCCTTTACAAATCATTTTAAGCAAGTCTTTTCTGATGTGCAGGCCAGAGAGAAAGA
       V  A  F  T  N  H  F  K  Q  V  F  S  D  V  Q  A  R  E  K  E  -931
21      W  P  L  Q  I  I  L  S  K  S  F  L  M  C  R  P  E  R  K  S
      C  G  L  Y  K  S  F  *  A  S  L  F  *  C  A  G  Q  R  E  R
               .           .         .         .         .         .
 3001 GCTACAGACAA | TTTTTGACACTTTGCCACCAATGCGCTATCAGGAGACCATGAGTGCCAT   R06
       L  Q  T  I |   F  D  T  L  P  P  M  R  Y  Q  E  T  M  S  A  I  -951
21      Y  R  Q   | F  L  T  L  C  H  Q  C  A  I  R  R  P  *  V  P  S
      A  T  D  N  |  F  *  H  F  A  T  N  A  L  S  G  D  H  E  C  H
               .         .         .         .         .         .
 3061 CAGGACATGGGTCCAGCAGTCAGAAACCAAACTCTCCATACCTCAACTTAGTGTCACCGA
 20    R  T  W  V  Q  Q  S  E  T  K  L  S  I  P  Q  L  S  V  T  D  -971
22      G  H  G  S  S  S  Q  K  P  N  S  P  Y  L  N  L  V  S  P  T
      Q  D  M  G  P  A  V  R  N  Q  T  L  H  T  S  T  *  C  H  R
               .         .         .            .         .         .
 3121 CTATGAAATCATGGAGCAGAGACTCGGGGAATTGCAG | GCTTTACAAAGTTCTCTGCAAGA
       Y  E  I  M  E  Q  R  L  G  E  L  Q   | A  L  Q  S  S  L  Q  E  -991
22      M  K  S  W  S  R  D  S  G  N  C  R  |  L  Y  K  V  L  C  K  S
      L  *  N  H  G  A  E  T  R  G  I  A  G |   F  T  K  F  S  A  R 
               .         .         .         .         .         .
 3181 GCAACAAAGTGGCCTATACTATCTCAGCACCACTGTGAAAGAGATGTCGAAGAAAGCGCC
 20    Q  Q  S  G  L  Y  Y  L  S  T  T  V  K  E  M  S  K  K  A  P  -1011
23      N  K  V  A  Y  T  I  S  A  P  L  *  K  R  C  R  R  K  R  P
      A  T  K  W  P  I  L  S  Q  H  H  C  E  R  D  V  E  E  S  A 
               .         .         .         .         .         .
 3241 CTCTGAAATTAGCCGGAAATATCAATCAGAATTTGAAGAAATTGAGGGACGCTGGAAGAA
       S  E  I  S  R  K  Y  Q  S  E  F  E  E  I  E  G  R  W  K  K  -1031
23      L  K  L  A  G  N  I  N  Q  N  L  K  K  L  R  D  A  G  R  S
      L  *  N  *  P  E  I  S  I  R  I  *  R  N  *  G  T  L  E  E  
               .         .         .         .         .         .
 3301 GCTCTCCTCCCAGCTGGTTGAGCATTGTCAAAAGCTAGAGGAGCAAATGAATAAACTCCG   R07
       L  S  S  Q  L  V  E  H  C  Q  K  L  E  E  Q  M  N  K  L  R  -1051
23      S  P  P  S  W  L  S  I  V  K  S  *  R  S  K  *  I  N  S  E
      A  L  L  P  A  G  *  A  L  S  K  A  R  G  A  N  E  *  T  P  
               .            .         .         .         .         .
 3361 AAAAATTCAG | AATCACATACAAACCCTGAAGAAATGGATGGCTGAAGTTGATGTTTTTCT
       K  I  Q   | N  H  I  Q  T  L  K  K  W  M  A  E  V  D  V  F  L  -1071
23      K  F  R  |  I  T  Y  K  P  *  R  N  G  W  L  K  L  M  F  F  *
      K  N  S  E |   S  H  T  N  P  E  E  M  D  G  *  S  *  C  F  S
               .         .         .         .         .         .
 3421 GAAGGAGGAATGGCCTGCCCTTGGGGATTCAGAAATTCTAAAAAAGCAGCTGAAACAGTG
 20    K  E  E  W  P  A  L  G  D  S  E  I  L  K  K  Q  L  K  Q  C  -1091
24      R  R  N  G  L  P  L  G  I  Q  K  F  *  K  S  S  *  N  S  A
      E  G  G  M  A  C  P  W  G  F  R  N  S  K  K  A  A  E  T  V
                  .         .         .         .         .         .
 3481 CAGA | CTTTTAGTCAGTGATATTCAGACAATTCAGCCCAGTCTAAACAGTGTCAATGAAGG
       R   | L  L  V  S  D  I  Q  T  I  Q  P  S  L  N  S  V  N  E  G  -1111
24      D  |  F  *  S  V  I  F  R  Q  F  S  P  V  *  T  V  S  M  K  V
      Q  T |   F  S  Q  *  Y  S  D  N  S  A  Q  S  K  Q  C  Q  *  R
               .         .         .         .         .         .
 3541 TGGGCAGAAGATAAAGAATGAAGCAGAGCCAGAGTTTGCTTCGAGACTTGAGACAGAACT
 20    G  Q  K  I  K  N  E  A  E  P  E  F  A  S  R  L  E  T  E  L  -1131
25      G  R  R  *  R  M  K  Q  S  Q  S  L  L  R  D  L  R  Q  N  S
      W  A  E  D  K  E  *  S  R  A  R  V  C  F  E  T  *  D  R  T
               .         .         .         .            .         .
 3601 CAAAGAACTTAACACTCAGTGGGATCACATGTGCCAACAG | GTCTATGCCAGAAAGGAGGC
       K  E  L  N  T  Q  W  D  H  M  C  Q  Q   | V  Y  A  R  K  E  A  -1151
25      K  N  L  T  L  S  G  I  T  C  A  N  R  |  S  M  P  E  R  R  P
      Q  R  T  *  H  S  V  G  S  H  V  P  T  G |   L  C  Q  K  G  G
               .         .         .         .         .         .
 3661 CTTGAAGGGAGGTTTGGAGAAAACTGTAAGCCTCCAGAAAGATCTATCAGAGATGCACGA   R08
 5.2a  L  K  G  G  L  E  K  T  V  S  L  Q  K  D  L  S  E  M  H  E  -1171
26      *  R  E  V  W  R  K  L  *  A  S  R  K  I  Y  Q  R  C  T  N
      L  E  G  R  F  G  E  N  C  K  P  P  E  R  S  I  R  D  A  R
               .         .         .         .         .         .
 3721 ATGGATGACACAAGCTGAAGAAGAGTATCTTGAGAGAGATTTTGAATATAAAACTCCAGA
       W  M  T  Q  A  E  E  E  Y  L  E  R  D  F  E  Y  K  T  P  D  -1191
26      G  *  H  K  L  K  K  S  I  L  R  E  I  L  N  I  K  L  Q  M
      M  D  D  T  S  *  R  R  V  S  *  E  R  F  *  I  *  N  S  R
               .         .         .            .         .         .
 3781 TGAATTACAGAAAGCAGTTGAAGAGATGAAG | AGAGCTAAAGAAGAGGCCCAACAAAAAGA
       E  L  Q  K  A  V  E  E  M  K   | R  A  K  E  E  A  Q  Q  K  E  -1211
26      N  Y  R  K  Q  L  K  R  *  R  |  E  L  K  K  R  P  N  K  K  K
      *  I  T  E  S  S  *  R  D  E  E |   S  *  R  R  G  P  T  K  R
               .         .         .         .         .         .
 3841 AGCGAAAGTGAAACTCCTTACTGAGTCTGTAAATAGTGTCATAGCTCAAGCTCCACCTGT
 5.2b  A  K  V  K  L  L  T  E  S  V  N  S  V  I  A  Q  A  P  P  V  -1231
27      R  K  *  N  S  L  L  S  L  *  I  V  S  *  L  K  L  H  L  *
      S  E  S  E  T  P  Y  *  V  C  K  *  C  H  S  S  S  S  T  C
               .         .         .         .         .         .
 3901 AGCACAAGAGGCCTTAAAAAAGGAACTTGAAACTCTAACCACCAACTACCAGTGGCTCTG
       A  Q  E  A  L  K  K  E  L  E  T  L  T  T  N  Y  Q  W  L  C  -1251
27      H  K  R  P  *  K  R  N  L  K  L  *  P  P  T  T  S  G  S  A
      S  T  R  G  L  K  K  G  T  *  N  S  N  H  Q  L  P  V  A  L
               .         .         .            .         .         .
 3961 CACTAGGCTGAATGGGAAATGCAAGACTTTGGAA | GAAGTTTGGGCATGTTGGCATGAGTT   R09
       T  R  L  N  G  K  C  K  T  L  E   | E  V  W  A  C  W  H  E  L  -1271
27      L  G  *  M  G  N  A  R  L  W  K  |  K  F  G  H  V  G  M  S  Y
      H  *  A  E  W  E  M  Q  D  F  G  R |   S  L  G  M  L  A  *  V
               .         .         .         .         .         .
 4021 ATTGTCATACTTGGAGAAAGCAAACAAGTGGCTAAATGAAGTAGAATTTAAACTTAAAAC
 11    L  S  Y  L  E  K  A  N  K  W  L  N  E  V  E  F  K  L  K  T  -1291
28      C  H  T  W  R  K  Q  T  S  G  *  M  K  *  N  L  N  L  K  P
      I  V  I  L  G  E  S  K  Q  V  A  K  *  S  R  I  *  T  *  N
               .         .         .         .            .         .
 4081 CACTGAAAACATTCCTGGCGGAGCTGAGGAAATCTCTGAGGTGCTAGAT | TCACTTGAAAA
       T  E  N  I  P  G  G  A  E  E  I  S  E  V  L  D   | S  L  E  N  -1311
28      L  K  T  F  L  A  E  L  R  K  S  L  R  C  *  I  |  H  L  K  I
      H  *  K  H  S  W  R  S  *  G  N  L  *  G  A  R  F |   T  *  K
               .         .         .         .         .         .
 4141 TTTGATGCGACATTCAGAGGATAACCCAAATCAGATTCGCATATTGGCACAGACCCTAAC
 11    L  M  R  H  S  E  D  N  P  N  Q  I  R  I  L  A  Q  T  L  T  -1331
29      *  C  D  I  Q  R  I  T  Q  I  R  F  A  Y  W  H  R  P  *  Q
      F  D  A  T  F  R  G  *  P  K  S  D  S  H  I  G  T  D  P  N
               .         .         .         .         .         .
 4201 AGATGGCGGAGTCATGGATGAGCTAATCAATGAGGAACTTGAGACATTTAATTCTCGTTG
       D  G  G  V  M  D  E  L  I  N  E  E  L  E  T  F  N  S  R  W  -1351
29      M  A  E  S  W  M  S  *  S  M  R  N  L  R  H  L  I  L  V  G
      R  W  R  S  H  G  *  A  N  Q  *  G  T  *  D  I  *  F  S  L
               .            .         .         .         .         .
 4261 GAGGGAACTACATGAAGAG | GCTGTAAGGAGGCAAAAGTTGCTTGAACAGAGCATCCAGTC   R10
       R  E  L  H  E  E   | A  V  R  R  Q  K  L  L  E  Q  S  I  Q  S  -1371
29      G  N  Y  M  K  R  |  L  *  G  G  K  S  C  L  N  R  A  S  S  L
      E  G  T  T  *  R  G |   C  K  E  A  K  V  A  *  T  E  H  P  V
               .         .         .         .         .         .
 4321 TGCCCAGGAGACTGAAAAATCCTTACACTTAATCCAGGAGTCCCTCACATTCATTGACAA
 4.7   A  Q  E  T  E  K  S  L  H  L  I  Q  E  S  L  T  F  I  D  K  -1391
30      P  R  R  L  K  N  P  Y  T  *  S  R  S  P  S  H  S  L  T  S
22    C  P  G  D  *  K  I  L  T  L  N  P  G  V  P  H  I  H  *  Q
               .         .         .         .         .         .
 4381 GCAGTTGGCAGCTTATATTGCAGACAAGGTGGACGCAGCTCAAATGCCTCAGGAAGCCCA
       Q  L  A  A  Y  I  A  D  K  V  D  A  A  Q  M  P  Q  E  A  Q  -1411
30      S  W  Q  L  I  L  Q  T  R  W  T  Q  L  K  C  L  R  K  P  R
      A  V  G  S  L  Y  C  R  Q  G  G  R  S  S  N  A  S  G  S  P
                  .         .         .         .         .         .
 4441 G | AAAATCCAATCTGATTTGACAAGTCATGAGATCAGTTTAGAAGAAATGAAGAAACATAA
        | K  I  Q  S  D  L  T  S  H  E  I  S  L  E  E  M  K  K  H  N  -1431
30      |  K  S  N  L  I  *  Q  V  M  R  S  V  *  K  K  *  R  N  I  I
      E |   N  P  I  *  F  D  K  S  *  D  Q  F  R  R  N  E  E  T  *
               .         .         .         .         .            .
 4501 TCAGGGGAAGGAGGCTGCCCAAAGAGTCCTGTCTCAGATTGATGTTGCACAG | AAAAAATT
 18    Q  G  K  E  A  A  Q  R  V  L  S  Q  I  D  V  A  Q   | K  K  L  -1451
        R  G  R  R  L  P  K  E  S  C  L  R  L  M  L  H  R  |  K  N  Y
23    S  G  E  G  G  C  P  K  S  P  V  S  D  *  C  C  T  E |   K  I
               .         .         .         .         .         .
 4561 ACAAGATGTCTCCATGAAGTTTCGATTATTCCAGAAACCAGCCAATTTTGAGCAGCGTCT   R11
 18    Q  D  V  S  M  K  F  R  L  F  Q  K  P  A  N  F  E  Q  R  L  -1471
32      K  M  S  P  *  S  F  D  Y  S  R  N  Q  P  I  L  S  S  V  Y
      T  R  C  L  H  E  V  S  I  I  P  E  T  S  Q  F  *  A  A  S
               .         .         .         .         .         .
 4621 ACAAGAAAGTAAGATGATTTTAGATGAAGTGAAGATGCACTTGCCTGCATTGGAAACAAA
       Q  E  S  K  M  I  L  D  E  V  K  M  H  L  P  A  L  E  T  K  -1491
32      K  K  V  R  *  F  *  M  K  *  R  C  T  C  L  H  W  K  Q  R
      T  R  K  *  D  D  F  R  *  S  E  D  A  L  A  C  I  G  N  K
               .         .         .         .            .         .
 4681 GAGTGTGGAACAGGAAGTAGTACAGTCACAGCTAAATCATTGTGTG | AACTTGTATAAAAG
       S  V  E  Q  E  V  V  Q  S  Q  L  N  H  C  V   | N  L  Y  K  S  -1511
32      V  W  N  R  K  *  Y  S  H  S  *  I  I  V  *  |  T  C  I  K  V
      E  C  G  T  G  S  S  T  V  T  A  K  S  L  C  E |   L  V  *  K
               .         .         .         .         .         .
 4741 TCTGAGTGAAGTGAAGTCTGAAGTGGAAATGGTGATAAAGACTGGACGTCAGATTGTACA
 18    L  S  E  V  K  S  E  V  E  M  V  I  K  T  G  R  Q  I  V  Q  -1531
33      *  V  K  *  S  L  K  W  K  W  *  *  R  L  D  V  R  L  Y  R
      S  E  *  S  E  V  *  S  G  N  G  D  K  D  W  T  S  D  C  T
               .         .         .         .         .         .
 4801 GAAAAAGCAGACGGAAAATCCCAAAGAACTTGATGAAAGAGTAACAGCTTTGAAATTGCA
       K  K  Q  T  E  N  P  K  E  L  D  E  R  V  T  A  L  K  L  H  -1551
33      K  S  R  R  K  I  P  K  N  L  M  K  E  *  Q  L  *  N  C  I
      E  K  A  D  G  K  S  Q  R  T  *  *  K  S  N  S  F  E  I  A
               .         .            .         .         .         .
 4861 TTATAATGAGCTGGGAGCAAAG | GTAACAGAAAGAAAGCAACAGTTGGAGAAATGCTTGAA   R12
       Y  N  E  L  G  A  K   | V  T  E  R  K  Q  Q  L  E  K  C  L  K  -1571
33      I  M  S  W  E  Q  R  |  *  Q  K  E  S  N  S  W  R  N  A  *  N
      L  *  *  A  G  S  K  G |   N  R  K  K  A  T  V  G  E  M  L  E
               .         .         .         .         .         .
 4921 ATTGTCCCGTAAGATGCGAAAGGAAATGAATGTCTTGACAGAATGGCTGGCAGCTACAGA
 1.8   L  S  R  K  M  R  K  E  M  N  V  L  T  E  W  L  A  A  T  D  -1591
34      C  P  V  R  C  E  R  K  *  M  S  *  Q  N  G  W  Q  L  Q  I
      I  V  P  *  D  A  K  G  N  E  C  L  D  R  M  A  G  S  Y  R
               .         .         .         .         .         .
 4981 TATGGAATTGACAAAGAGATCAGCAGTTGAAGGAATGCCTAGTAATTTGGATTCTGAAGT
       M  E  L  T  K  R  S  A  V  E  G  M  P  S  N  L  D  S  E  V  -1611
34      W  N  *  Q  R  D  Q  Q  L  K  E  C  L  V  I  W  I  L  K  L
      Y  G  I  D  K  E  I  S  S  *  R  N  A  *  *  F  G  F  *  S
               .            .         .         .         .         .
 5041 TGCCTGGGGAAAG | GCTACTCAAAAAGAGATTGAGAAACAGAAGGTGCACCTGAAGAGTAT
       A  W  G  K   | A  T  Q  K  E  I  E  K  Q  K  V  H  L  K  S  I  -1631
34      P  G  E  R  |  L  L  K  K  R  L  R  N  R  R  C  T  *  R  V  S
      C  L  G  K  G |   Y  S  K  R  D  *  E  T  E  G  A  P  E  E  Y
               .         .         .         .         .         .
 5101 CACAGAGGTAGGAGAGGCCTTGAAAACAGTTTTGGGCAAGAAGGAGACGTTGGTGGAAGA
 0.4   T  E  V  G  E  A  L  K  T  V  L  G  K  K  E  T  L  V  E  D  -1651
35      Q  R  *  E  R  P  *  K  Q  F  W  A  R  R  R  R  W  W  K  I
      H  R  G  R  R  G  L  E  N  S  F  G  Q  E  G  D  V  G  G  R
               .         .         .         .         .         .
 5161 TAAACTCAGTCTTCTGAATAGTAACTGGATAGCTGTCACCTCCCGAGCAGAAGAGTGGTT
       K  L  S  L  L  N  S  N  W  I  A  V  T  S  R  A  E  E  W  L  -1671
35      N  S  V  F  *  I  V  T  G  *  L  S  P  P  E  Q  K  S  G  *
      *  T  Q  S  S  E  *  *  L  D  S  C  H  L  P  S  R  R  V  V
               .            .         .         .         .         .
 5221 AAATCTTTTGTTG | GAATACCAGAAACACATGGAAACTTTTGACCAGAATGTGGACCACAT   R13
       N  L  L  L   | E  Y  Q  K  H  M  E  T  F  D  Q  N  V  D  H  I  -1691
35      I  F  C  W  |  N  T  R  N  T  W  K  L  L  T  R  M  W  T  T  S
      K  S  F  V  G |   I  P  E  T  H  G  N  F  *  P  E  C  G  P  H
               .         .         .         .         .         .
 5281 CACAAAGTGGATCATTCAGGCTGACACACTTTTGGATGAATCAGAGAAAAAGAAACCCCA
 1.3   T  K  W  I  I  Q  A  D  T  L  L  D  E  S  E  K  K  K  P  Q  -1711
36      Q  S  G  S  F  R  L  T  H  F  W  M  N  Q  R  K  R  N  P  S
      H  K  V  D  H  S  G  *  H  T  F  G  *  I  R  E  K  E  T  P
               .         .            .         .         .         .
 5341 GCAAAAAGAAGACGTGCTTAAG | CGTTTAAAGGCAGAACTGAATGACATACGCCCAAAGGT
       Q  K  E  D  V  L  K   | R  L  K  A  E  L  N  D  I  R  P  K  V  -1731
36      K  K  K  T  C  L  S  |  V  *  R  Q  N  *  M  T  Y  A  Q  R  W
      A  K  R  R  R  A  *  A |   F  K  G  R  T  E  *  H  T  P  K  G
               .         .         .         .         .         .
 5401 GGACTCTACACGTGACCAAGCAGCAAACTTGATGGCAAACCGCGGTGACCACTGCAGGAA
 1.5   D  S  T  R  D  Q  A  A  N  L  M  A  N  R  G  D  H  C  R  K  -1751
37      T  L  H  V  T  K  Q  Q  T  *  W  Q  T  A  V  T  T  A  G  N
      G  L  Y  T  *  P  S  S  K  L  D  G  K  P  R  *  P  L  Q  E
               .         .         .         .         .         .
 5461 ATTAGTAGAGCCCCAAATCTCAGAGCTCAACCATCGATTTGCAGCCATTTCACACAGAAT
       L  V  E  P  Q  I  S  E  L  N  H  R  F  A  A  I  S  H  R  I  -1771
37      *  *  S  P  K  S  Q  S  S  T  I  D  L  Q  P  F  H  T  E  L
      I  S  R  A  P  N  L  R  A  Q  P  S  I  C  S  H  F  T  Q  N
               .            .         .         .         .         .
 5521 TAAGACTGGAAAG | GCCTCCATTCCTTTGAAGGAATTGGAGCAGTTTAACTCAGATATACA   R14
       K  T  G  K   | A  S  I  P  L  K  E  L  E  Q  F  N  S  D  I  Q  -1791
37      R  L  E  R  |  P  P  F  L  *  R  N  W  S  S  L  T  Q  I  Y  K
      *  D  W  K  G |   L  H  S  F  E  G  I  G  A  V  *  L  R  Y  T
               .         .         .         .         .         .
 5581 AAAATTGCTTGAACCACTGGAGGCTGAAATTCAGCAGGGGGTGAATCTGAAAGAGGAAGA
 6.1   K  L  L  E  P  L  E  A  E  I  Q  Q  G  V  N  L  K  E  E  D  -1811
38      N  C  L  N  H  W  R  L  K  F  S  R  G  *  I  *  K  R  K  T
28    K  I  A  *  T  T  G  G  *  N  S  A  G  G  E  S  E  R  G  R
               .            .         .         .         .         .
 5641 CTTCAATAAAGATATG | AATGAAGACAATGAGGGTACTGTAAAAGAATTGTTGCAAAGAGG
       F  N  K  D  M   | N  E  D  N  E  G  T  V  K  E  L  L  Q  R  G  -1831
38      S  I  K  I  *  |  M  K  T  M  R  V  L  *  K  N  C  C  K  E  E
      L  Q  *  R  Y  E |   *  R  Q  *  G  Y  C  K  R  I  V  A  K  R
               .         .         .         .         .         .
 5701 AGACAACTTACAACAAAGAATCACAGATGAGAGAAAGCGAGAGGAAATAAAGATAAAACA
 6.1   D  N  L  Q  Q  R  I  T  D  E  R  K  R  E  E  I  K  I  K  Q  -1851
39      T  T  Y  N  K  E  S  Q  M  R  E  S  E  R  K  *  R  *  N  S
      R  Q  L  T  T  K  N  H  R  *  E  K  A  R  G  N  K  D  K  T
               .         .         .            .         .         .
 5761 GCAGCTGTTACAGACAAAACATAATGCTCTCAAG | GATTTGAGGTCTCAAAGAAGAAAAAA
       Q  L  L  Q  T  K  H  N  A  L  K   | D  L  R  S  Q  R  R  K  K  -1871
39      S  C  Y  R  Q  N  I  M  L  S  R  |  I  *  G  L  K  E  E  K  R
      A  A  V  T  D  K  T  *  C  S  Q  G |   F  E  V  S  K  K  K  K
               .         .         .         .         .         .
 5821 GGCTCTAGAAATTTCTCATCAGTGGTATCAGTACAAGAGGCAGGCTGATGATCTCCTGAA   R15
 6.2   A  L  E  I  S  H  Q  W  Y  Q  Y  K  R  Q  A  D  D  L  L  K  -1891
40      L  *  K  F  L  I  S  G  I  S  T  R  G  R  L  M  I  S  *  N
      G  S  R  N  F  S  S  V  V  S  V  Q  E  A  G  *  *  S  P  E
               .         .         .         .         .         .
 5881 ATGCTTGGATGACATTGAAAAAAAATTAGCCAGCCTACCTGAGCCCAGAGATGAAAGGAA
       C  L  D  D  I  E  K  K  L  A  S  L  P  E  P  R  D  E  R  K  -1911
40      A  W  M  T  L  K  K  N  *  P  A  Y  L  S  P  E  M  K  G  K
      M  L  G  *  H  *  K  K  I  S  Q  P  T  *  A  Q  R  *  K  E
                  .         .         .         .         .         .
 5941 AATAAAG | GAAATTGATCGGGAATTGCAGAAGAAGAAAGAGGAGCTGAATGCAGTGCGTAG
       I  K   | E  I  D  R  E  L  Q  K  K  K  E  E  L  N  A  V  R  R  -1931
40      *  R  |  K  L  I  G  N  C  R  R  R  K  R  S  *  M  Q  C  V  G
      N  K  G |   N  *  S  G  I  A  E  E  E  R  G  A  E  C  S  A  *
               .         .         .         .         .         .
 6001 GCAAGCTGAGGGCTTGTCTGAGGATGGGGCCGCAATGGCAGTGGAGCCAACTCAGATCCA
 6.2   Q  A  E  G  L  S  E  D  G  A  A  M  A  V  E  P  T  Q  I  Q  -1951
41      K  L  R  A  C  L  R  M  G  P  Q  W  Q  W  S  Q  L  R  S  S
      A  S  *  G  L  V  *  G  W  G  R  N  G  S  G  A  N  S  D  P
               .         .         .         .         .         .
 6061 GCTCAGCAAGCGCTGGCGGGAAATTGAGAGCAAATTTGCTCAGTTTCGAAGACTCAACTT
       L  S  K  R  W  R  E  I  E  S  K  F  A  Q  F  R  R  L  N  F  -1971
41      S  A  S  A  G  G  K  L  R  A  N  L  L  S  F  E  D  S  T  L
      A  Q  Q  A  L  A  G  N  *  E  Q  I  C  S  V  S  K  T  Q  L
               .            .         .         .         .         .
 6121 TGCACAAATT | CACACTGTCCGTGAAGAAACGATGATGGTGATGACTGAAGACATGCCTTT  hinge 2
       A  Q  I   | H  T  V  R  E  E  T  M  M  V  M  T  E  D  M  P  L  -1991
41      H  K  F  |  T  L  S  V  K  K  R  *  W  *  *  L  K  T  C  L  W 
      C  T  N  S |   H  C  P  *  R  N  D  D  G  D  D  *  R  H  A  F 
               .         .         .         .         .         .
 6181 GGAAATTTCTTATGTGCCTTCTACTTATTTGACTGAAATCACTCATGTCTCACAAGCCCT   R16
 4.2   E  I  S  Y  V  P  S  T  Y  L  T  E  I  T  H  V  S  Q  A  L  -2011
42      K  F  L  M  C  L  L  L  I  *  L  K  S  L  M  S  H  K  P  Y 
      G  N  F  L  C  A  F  Y  L  F  D  *  N  H  S  C  L  T  S  P   
               .         .         .         .         .         .
 6241 ATTAGAAGTGGAACAACTTCTCAATGCTCCTGACCTCTGTGCTAAGGACTTTGAAGATCT 
       L  E  V  E  Q  L  L  N  A  P  D  L  C  A  K  D  F  E  D  L  -2031
42      *  K  W  N  N  F  S  M  L  L  T  S  V  L  R  T  L  K  I  S
      I  R  S  G  T  T  S  Q  C  S  *  P  L  C  *  G  L  *  R  S   
               .         .            .         .         .         .
 6301 CTTTAAGCAAGAGGAGTCTCTGAAG | AATATAAAAGATAGTCTACAACAAAGCTCAGGTCG
       F  K  Q  E  E  S  L  K   | N  I  K  D  S  L  Q  Q  S  S  G  R  -2051
42      L  S  K  R  S  L  *  R  |  I  *  K  I  V  Y  N  K  A  Q  V  G
      L  *  A  R  G  V  S  E  E |   Y  K  R  *  S  T  T  K  L  R  S
               .         .         .         .         .         .
 6361 GATTGACATTATTCATAGCAAGAAGACAGCAGCATTGCAAAGTGCAACGCCTGTGGAAAG
 11    I  D  I  I  H  S  K  K  T  A  A  L  Q  S  A  T  P  V  E  R  -2071
43      L  T  L  F  I  A  R  R  Q  Q  H  C  K  V  Q  R  L  W  K  G
      D  *  H  Y  S  *  Q  E  D  S  S  I  A  K  C  N  A  C  G  K
               .         .         .         .         .         .
 6421 GGTGAAGCTACAGGAAGCTCTCTCCCAGCTTGATTTCCAATGGGAAAAAGTTAACAAAAT
       V  K  L  Q  E  A  L  S  Q  L  D  F  Q  W  E  K  V  N  K  M  -2091
43      *  S  Y  R  K  L  S  P  S  L  I  S  N  G  K  K  L  T  K  C
      G  E  A  T  G  S  S  L  P  A  *  F  P  M  G  K  S  *  Q  N
               .            .         .         .         .         .
 6481 GTACAAGGACCGACAAGG | GCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTA   R17
       Y  K  D  R  Q  G  |  R  F  D  R  S  V  E  K  W  R  R  F  H  Y  -2111
43      T  R  T  D  K  G |   D  L  T  D  L  L  R  N  G  G  V  F  I  M
      V  Q  G  P  T  R   | A  I  *  Q  I  C  *  E  M  A  A  F  S  L
               .         .         .         .         .         .
 6541 TGATATAAAGATATTTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACA
  4.1  D  I  K  I  F  N  Q  W  L  T  E  A  E  Q  F  L  R  K  T  Q  -2131
44      I  *  R  Y  L  I  S  G  *  Q  K  L  N  S  F  S  E  R  H  K
      *  Y  K  D  I  *  S  V  A  N  R  S  *  T  V  S  Q  K  D  T
               .         .         .         .            .         .
 6601 AATTCCTGAGAATTGGGAACATGCTAAATACAAATGGTATCTTAAG | GAACTCCAGGATGG
       I  P  E  N  W  E  H  A  K  Y  K  W  Y  L  K   | E  L  Q  D  G  -2151
44      F  L  R  I  G  N  M  L  N  T  N  G  I  L  R  |  N  S  R  M  A
      N  S  *  E  L  G  T  C  *  I  Q  M  V  S  *  G |   T  P  G  W
               .         .         .         .         .         .
 6661 CATTGGGCAGCGGCAAACTGTTGTCAGAACATTGAATGCAACTGGGGAAGAAATAATTCA
 0.5   I  G  Q  R  Q  T  V  V  R  T  L  N  A  T  G  E  E  I  I  Q  -2171
45      L  G  S  G  K  L  L  S  E  H  *  M  Q  L  G  K  K  *  F  S
      H  W  A  A  A  N  C  C  Q  N  I  E  C  N  W  G  R  N  N  S
               .         .         .         .         .         .
 6721 GCAATCCTCAAAAACAGATGCCAGTATTCTACAGGAAAAATTGGGAAGCCTGAATCTGCG
       Q  S  S  K  T  D  A  S  I  L  Q  E  K  L  G  S  L  N  L  R  -2191
45      N  P  Q  K  Q  M  P  V  F  Y  R  K  N  W  E  A  *  I  C  G
      A  I  L  K  N  R  C  Q  Y  S  T  G  K  I  G  K  P  E  S  A
               .         .         .         .            .         .
 6781 GTGGCAGGAGGTCTGCAAACAGCTGTCAGACAGAAAAAAGAG | GCTAGAAGAACAAAAGAA   R18
       W  Q  E  V  C  K  Q  L  S  D  R  K  K  R  |  L  E  E  Q  K  N  -2211
45      G  R  R  S  A  N  S  C  Q  T  E  K  R  G |   *  K  N  K  R  I
      V  A  G  G  L  Q  T  A  V  R  Q  K  K  E   | A  R  R  T  K  E
               .         .         .         .         .         .
 6841 TATCTTGTCAGAATTTCAAAGAGATTTAAATGAATTTGTTTTATGGTTGGAGGAAGCAGA
 1.5   I  L  S  E  F  Q  R  D  L  N  E  F  V  L  W  L  E  E  A  D  -2231
46      S  C  Q  N  F  K  E  I  *  M  N  L  F  Y  G  W  R  K  Q  I
      Y  L  V  R  I  S  K  R  F  K  *  I  C  F  M  V  G  G  S  R
               .         .         .         .         .         .
 6901 TAACATTGCTAGTATCCCACTTGAACCTGGAAAAGAGCAGCAACTAAAAGAAAAGCTTGA
       N  I  A  S  I  P  L  E  P  G  K  E  Q  Q  L  K  E  K  L  E  -2251
46      T  L  L  V  S  H  L  N  L  E  K  S  S  N  *  K  K  S  L  S
      *  H  C  *  Y  P  T  *  T  W  K  R  A  A  T  K  R  K  A  *
               .            .         .         .         .         .
 6961 GCAAGTCAAG | TTACTGGTGGAAGAGTTGCCCCTGCGCCAGGGAATTCTCAAACAATTAAA
       Q  V  K   | L  L  V  E  E  L  P  L  R  Q  G  I  L  K  Q  L  N  -2271
46      K  S  S  |  Y  W  W  K  S  C  P  C  A  R  E  F  S  N  N  *  M
      A  S  Q  V |   T  G  G  R  V  A  P  A  P  G  N  S  Q  T  I  K
               .         .         .         .         .         .
 7021 TGAAACTGGAGGACCCGTGCTTGTAAGTGCTCCCATAAGCCCAGAAGAGCAAGATAAACT
 10    E  T  G  G  P  V  L  V  S  A  P  I  S  P  E  E  Q  D  K  L  -2291
47      K  L  E  D  P  C  L  *  V  L  P  *  A  Q  K  S  K  I  N  L
      *  N  W  R  T  R  A  C  K  C  S  H  K  P  R  R  A  R  *  T
               .         .         .         .            .         .
 7081 TGAAAATAAGCTCAAGCAGACAAATCTCCAGTGGATAAAG | GTTTCCAGAGCTTTACCTGA
       E  N  K  L  K  Q  T  N  L  Q  W  I  K   | V  S  R  A  L  P  E  -2311
47      K  I  S  S  S  R  Q  I  S  S  G  *  R  |  F  P  E  L  Y  L  R
      *  K  *  A  Q  A  D  K  S  P  V  D  K  G |   F  Q  S  F  T  *
               .         .         .         .         .         .
 7141 GAAACAAGGAGAAATTGAAGCTCAAATAAAAGACCTTGGGCAGCTTGAAAAAAAGCTTGA   R19
 1.2   K  Q  G  E  I  E  A  Q  I  K  D  L  G  Q  L  E  K  K  L  E  -2331
48      N  K  E  K  L  K  L  K  *  K  T  L  G  S  L  K  K  S  L  K
      E  T  R  R  N  *  S  S  N  K  R  P  W  A  A  *  K  K  A  *
               .         .         .         .         .         .
 7201 AGACCTTGAAGAGCAGTTAAATCATCTGCTGCTGTGGTTATCTCCTATTAGGAATCAGTT
 3.9   D  L  E  E  Q  L  N  H  L  L  L  W  L  S  P  I  R  N  Q  L  -2351
48      T  L  K  S  S  *  I  I  C  C  C  G  Y  L  L  L  G  I  S  W
      R  P  *  R  A  V  K  S  S  A  A  V  V  I  S  Y  *  E  S  V
               .         .         .         .            .         .
 7261 GGAAATTTATAACCAACCAAACCAAGAAGGACCATTTGACGTTCAG | GAAACTGAAATAGC
       E  I  Y  N  Q  P  N  Q  E  G  P  F  D  V  Q   | E  T  E  I  A  -2371
48      K  F  I  T  N  Q  T  K  K  D  H  L  T  F  R  |  K  L  K  *  Q
      G  N  L  *  P  T  K  P  R  R  T  I  *  R  S  G |   N  *  N  S
               .         .         .         .         .         .
 7321 AGTTCAAGCTAAACAACCGGATGTGGAAGAGATTTTGTCTAAAGGGCAGCATTTGTACAA
 1.6   V  Q  A  K  Q  P  D  V  E  E  I  L  S  K  G  Q  H  L  Y  K  -2391
49      F  K  L  N  N  R  M  W  K  R  F  C  L  K  G  S  I  C  T  R
      S  S  S  *  T  T  G  C  G  R  D  F  V  *  R  A  A  F  V  Q
               .         .            .         .         .         .
 7381 GGAAAAACCAGCCACTCAGCCAGTGAAG | AGGAAGTTAGAAGATCTGAGCTCTGAGTGGAA
       E  K  P  A  T  Q  P  V  K   | R  K  L  E  D  L  S  S  E  W  K  -2411
49      K  N  Q  P  L  S  Q  *  R  |  G  S  *  K  I  *  A  L  S  G  R
      G  K  T  S  H  S  A  S  E  E |   E  V  R  R  S  E  L  *  V  E
               .         .         .         .         .         .
 7441 GGCGGTAAACCGTTTACTTCAAGAGCTGAGGGCAAAGCAGCCTGACCTAGCTCCTGGACT
 3.7   A  V  N  R  L  L  Q  E  L  R  A  K  Q  P  D  L  A  P  G  L  -2431
50      R  *  T  V  Y  F  K  S  *  G  Q  S  S  L  T  *  L  L  D  *
      G  G  K  P  F  T  S  R  A  E  G  K  A  A  *  P  S  S  W  T
               .            .         .         .         .         .
 7501 GACCACTATTGGAGCCT | CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTAC  hinge 3
       T  T  I  G  A  S |   P  T  Q  T  V  T  L  V  T  Q  P  V  V  T  -2451
50      P  L  L  E  P   | L  L  L  R  L  L  L  W  *  H  N  L  W  L  L
      D  H  Y  W  S  L  |  S  Y  S  D  C  Y  S  G  D  T  T  C  G  Y
               .         .         .         .         .         .
 7561 TAAGGAAACTGCCATCTCCAAACTAGAAATGCCATCTTCCTTGATGTTGGAGGTACCTGC
 3.1   K  E  T  A  I  S  K  L  E  M  P  S  S  L  M  L  E  V  P  A  -2471
51      R  K  L  P  S  P  N  *  K  C  H  L  P  *  C  W  R  Y  L  L
      *  G  N  C  H  L  Q  T  R  N  A  I  F  L  D  V  G  G  T  C
               .         .         .         .         .         .
 7621 TCTGGCAGATTTCAACCGGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCA   R20
       L  A  D  F  N  R  A  W  T  E  L  T  D  W  L  S  L  L  D  Q  -2491
51      W  Q  I  S  T  G  L  G  Q  N  L  P  T  G  F  L  C  L  I  K
      S  G  R  F  Q  P  G  L  D  R  T  Y  R  L  A  F  S  A  *  S
               .         .         .         .         .         .
 7681 AGTTATAAAATCACAGAGGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCAT
       V  I  K  S  Q  R  V  M  V  G  D  L  E  D  I  N  E  M  I  I  -2511
51      L  *  N  H  R  G  *  W  W  V  T  L  R  I  S  T  R  *  S  S
      S  Y  K  I  T  E  G  D  G  G  *  P  *  G  Y  Q  R  D  D  H
               .            .         .         .         .         .
 7741 CAAGCAGAAG | GCAACAATGCAGGATTTGGAACAGAGGCGTCCCCAGTTGGAAGAACTCAT   R22
       K  Q  K   | A  T  M  Q  D  L  E  Q  R  R  P  Q  L  E  E  L  I  -2531
51      S  R  R  |  Q  Q  C  R  I  W  N  R  G  V  P  S  W  K  N  S  L 
      Q  A  E  G |   N  N  A  G  F  G  T  E  A  S  P  V  G  R  T  H   
               .         .         .         .         .         .
 7801 TACCGCTGCCCAAAATTTGAAAAACAAGACCAGCAATCAAGAGGCTAGAACAATCATTAC
 7     T  A  A  Q  N  L  K  N  K  T  S  N  Q  E  A  R  T  I  I  T  -2551
52      P  L  P  K  I  *  K  T  R  P  A  I  K  R  L  E  Q  S  L  R 
      Y  R  C  P  K  F  E  K  Q  D  Q  Q  S  R  G  *  N  N  H  Y   
                  .         .         .         .         .         .
 7861 GGATCGAA | TTGAAAGAATTCAGAATCAGTGGGATGAAGTACAAGAACACCTTCAGAACCG
       D  R  I |   E  R  I  Q  N  Q  W  D  E  V  Q  E  H  L  Q  N  R  -2571
52      I  E   | L  K  E  F  R  I  S  G  M  K  Y  K  N  T  F  R  T  G
      G  S  N  |  *  K  N  S  E  S  V  G  *  S  T  R  T  P  S  E  P
               .         .         .         .         .         .
 7921 GAGGCAACAGTTGAATGAAATGTTAAAGGATTCAACACAATGGCTGGAAGCTAAGGAAGA   R21
 7.8   R  Q  Q  L  N  E  M  L  K  D  S  T  Q  W  L  E  A  K  E  E  -2591
53      G  N  S  *  M  K  C  *  R  I  Q  H  N  G  W  K  L  R  K  K
      E  A  T  V  E  *  N  V  K  G  F  N  T  M  A  G  S  *  G  R
               .         .         .         .         .         .
 7981 AGCTGAGCAGGTCTTAGGACAGGCCAGAGCCAAGCTTGAGTCATGGAAGGAGGGTCCCTA
       A  E  Q  V  L  G  Q  A  R  A  K  L  E  S  W  K  E  G  P  Y  -2611
53      L  S  R  S  *  D  R  P  E  P  S  L  S  H  G  R  R  V  P  I
      S  *  A  G  L  R  T  G  Q  S  Q  A  *  V  M  E  G  G  S  L
               .         .         .         .            .         .
 8041 TACAGTAGATGCAATCCAAAAGAAAATCACAGAAACCAAG | CAGTTGGCCAAAGACCTCCG
 1.0   T  V  D  A  I  Q  K  K  I  T  E  T  K   | Q  L  A  K  D  L  R  -2631
53      Q  *  M  Q  S  K  R  K  S  Q  K  P  S  |  S  W  P  K  T  S  A
      Y  S  R  C  N  P  K  E  N  H  R  N  Q  A |   V  G  Q  R  P  P
               .         .         .         .         .         .
 8101 CCAGTGGCAGACAAATGTAGATGTGGCAAATGACTTGGCCCTGAAACTTCTCCGGGATTA
 8.3   Q  W  Q  T  N  V  D  V  A  N  D  L  A  L  K  L  L  R  D  Y  -2651
54      S  G  R  Q  M  *  M  W  Q  M  T  W  P  *  N  F  S  G  I  I
      P  V  A  D  K  C  R  C  G  K  *  L  G  P  E  T  S  P  G  L
               .         .         .         .         .         .
 8161 TTCTGCAGATGATACCAGAAAAGTCCACATGATAACAGAGAATATCAATGCCTCTTGGAG
       S  A  D  D  T  R  K  V  H  M  I  T  E  N  I  N  A  S  W  R  -2671
54      L  Q  M  I  P  E  K  S  T  *  *  Q  R  I  S  M  P  L  G  E
      F  C  R  *  Y  Q  K  S  P  H  D  N  R  E  Y  Q  C  L  L  E
               .            .         .         .         .         .
 8221 AAGCATTCATAAAAG | GGTGAGTGAGCGAGAGGCTGCTTTGGAAGAAACTCATAGATTACT   R22
       S  I  H  K  R  |  V  S  E  R  E  A  A  L  E  E  T  H  R  L  L  -2691
54      A  F  I  K  G |   *  V  S  E  R  L  L  W  K  K  L  I  D  Y  C
      K  H  S  *  K   | G  E  *  A  R  G  C  F  G  R  N  S  *  I  T
               .         .         .         .         .         .
 8281 GCAACAGTTCCCCCTGGACCTGGAAAAGTTTCTTGCCTGGCTTACAGAAGCTGAAACAAC
 2.3   Q  Q  F  P  L  D  L  E  K  F  L  A  W  L  T  E  A  E  T  T  -2711
55      N  S  S  P  W  T  W  K  S  F  L  P  G  L  Q  K  L  K  Q  L
      A  T  V  P  P  G  P  G  K  V  S  C  L  A  Y  R  S  *  N  N
               .         .         .         .         .         .
 8341 TGCCAATGTCCTACAGGATGCTACCCGTAAGGAAAGGCTCCTAGAAGACTCCAAGGGAGT
       A  N  V  L  Q  D  A  T  R  K  E  R  L  L  E  D  S  K  G  V  -2731
55      P  M  S  Y  R  M  L  P  V  R  K  G  S  *  K  T  P  R  E  *
      C  Q  C  P  T  G  C  Y  P  *  G  K  A  P  R  R  L  Q  G  S
               .         .            .         .         .         .
 8401 AAAAGAGCTGATGAAACAATGGCAA | GACCTCCAAGGTGAAATTGAAGCTCACACAGATGT
       K  E  L  M  K  Q  W  Q   | D  L  Q  G  E  I  E  A  H  T  D  V  -2751
55      K  S  *  *  N  N  G  K  |  T  S  K  V  K  L  K  L  T  Q  M  F
      K  R  A  D  E  T  M  A  R |   P  P  R  *  N  *  S  S  H  R  C
               .         .         .         .         .         .
 8461 TTATCACAACCTGGATGAAAACAGCCAAAAAATCCTGAGATCCCTGGAAGGTTCCGATGA
 8.8   Y  H  N  L  D  E  N  S  Q  K  I  L  R  S  L  E  G  S  D  D  -2771
56      I  T  T  W  M  K  T  A  K  K  S  *  D  P  W  K  V  P  M  M
      L  S  Q  P  G  *  K  Q  P  K  N  P  E  I  P  G  R  F  R  *
               .         .         .         .         .         .
 8521 TGCAGTCCTGTTACAAAGACGTTTGGATAACATGAACTTCAAGTGGAGTGAACTTCGGAA
       A  V  L  L  Q  R  R  L  D  N  M  N  F  K  W  S  E  L  R  K  -2791
56      Q  S  C  Y  K  D  V  W  I  T  *  T  S  S  G  V  N  F  G  K
      C  S  P  V  T  K  T  F  G  *  H  E  L  Q  V  E  *  T  S  E
               .            .         .         .         .         .
 8581 AAAGTCTCTCAACATTAG | GTCCCATTTGGAAGCCAGTTCTGACCAGTGGAAGCGTCTGCA   R23
       K  S  L  N  I  R  |  S  H  L  E  A  S  S  D  Q  W  K  R  L  H  -2811
56      S  L  S  T  L  G |   P  I  W  K  P  V  L  T  S  G  S  V  C  T
      K  V  S  Q  H  *   | V  P  F  G  S  Q  F  *  P  V  E  A  S  A 
               .         .         .         .         .         .
 8641 CCTTTCTCTGCAGGAACTTCTGGTGTGGCTACAGCTGAAAGATGATGAATTAAGCCGGCA
 1.0   L  S  L  Q  E  L  L  V  W  L  Q  L  K  D  D  E  L  S  R  Q  -2831
57      F  L  C  R  N  F  W  C  G  Y  S  *  K  M  M  N  *  A  G  R
      P  F  S  A  G  T  S  G  V  A  T  A  E  R  *  *  I  K  P  A  
               .         .         .         .         .            .
 8701 GGCACCTATTGGAGGCGACTTTCCAGCAGTTCAGAAGCAGAACGATGTACATAGG | GCCTT
       A  P  I  G  G  D  F  P  A  V  Q  K  Q  N  D  V  H  R   | A  F  -2851
57      H  L  L  E  A  T  F  Q  Q  F  R  S  R  T  M  Y  I  G  |  P  S
      G  T  Y  W  R  R  L  S  S  S  S  E  A  E  R  C  T  *  G |   L
               .         .         .         .         .         .
 8761 CAAGAGGGAATTGAAAACTAAAGAACCTGTAATCATGAGTACTCTTGAGACTGTACGAAT
 6.0   K  R  E  L  K  T  K  E  P  V  I  M  S  T  L  E  T  V  R  I  -2871
58      R  G  N  *  K  L  K  N  L  *  S  *  V  L  L  R  L  Y  E  Y
      Q  E  G  I  E  N  *  R  T  C  N  H  E  Y  S  *  D  C  T  N
               .         .         .         .         .            .
 8821 ATTTCTGACAGAGCAGCCTTTGGAAGGACTAGAGAAACTCTACCAGGAGCCCAGAG | AGCT
       F  L  T  E  Q  P  L  E  G  L  E  K  L  Y  Q  E  P  R  E |   L  -2891
58      F  *  Q  S  S  L  W  K  D  *  R  N  S  T  R  S  P  E   | S  C
      I  S  D  R  A  A  F  G  R  T  R  E  T  L  P  G  A  Q  R  |  A
               .         .         .         .         .         .
 8881 GCCTCCTGAGGAGAGAGCCCAGAATGTCACTCGGCTTCTACGAAAGCAGGCTGAGGAGGT
 6.0   P  P  E  E  R  A  Q  N  V  T  R  L  L  R  K  Q  A  E  E  V  -2911
59      L  L  R  R  E  P  R  M  S  L  G  F  Y  E  S  R  L  R  R  S
      A  S  *  G  E  S  P  E  C  H  S  A  S  T  K  A  G  *  G  G
               .         .         .         .         .         .
 8941 CAATACTGAGTGGGAAAAATTGAACCTGCACTCCGCTGACTGGCAGAGAAAAATAGATGA
       N  T  E  W  E  K  L  N  L  H  S  A  D  W  Q  R  K  I  D  E  -2931
59      I  L  S  G  K  N  *  T  C  T  P  L  T  G  R  E  K  *  M  R
      Q  Y  *  V  G  K  I  E  P  A  L  R  *  L  A  E  K  N  R  *
               .         .         .         .         .         .
 9001 GACCCTTGAAAGACTCCAGGAACTTCAAGAGGCCACGGATGAGCTGGACCTCAAGCTGCG   R24
       T  L  E  R  L  Q  E  L  Q  E  A  T  D  E  L  D  L  K  L  R  -2951
59      P  L  K  D  S  R  N  F  K  R  P  R  M  S  W  T  S  S  C  A
      D  P  *  K  T  P  G  T  S  R  G  H  G  *  A  G  P  Q  A  A
               .         .         .         .         .         .
 9061 CCAAGCTGAGGTGATCAAGGGATCCTGGCAGCCCGTGGGCGATCTCCTCATTGACTCTCT
       Q  A  E  V  I  K  G  S  W  Q  P  V  G  D  L  L  I  D  S  L  -2971
59      K  L  R  *  S  R  D  P  G  S  P  W  A  I  S  S  L  T  L  S
      P  S  *  G  D  Q  G  I  L  A  A  R  G  R  S  P  H  *  L  S
               .         .            .         .         .         .
 9121 CCAAGATCACCTCGAGAAAGTCAAG | GCACTTCGAGGAGAAATTGCGCCTCTGAAAGAGAA   R26
       Q  D  H  L  E  K  V  K   | A  L  R  G  E  I  A  P  L  K  E  N  -2991
59      K  I  T  S  R  K  S  R  |  H  F  E  E  K  L  R  L  *  K  R  T
      P  R  S  P  R  E  S  Q  G |   T  S  R  R  N  C  A  S  E  R  E
               .         .         .         .         .         .
 9181 CGTGAGCCACGTCAATGACCTTGCTCGCCAGCTTACCACTTTGGGCATTCAGCTCTCACC
 3.5   V  S  H  V  N  D  L  A  R  Q  L  T  T  L  G  I  Q  L  S  P  -3011
60      *  A  T  S  M  T  L  L  A  S  L  P  L  W  A  F  S  S  H  R
      R  E  P  R  Q  *  P  C  S  P  A  Y  H  F  G  H  S  A  L  T
               .         .         .         .         .            .
 9241 GTATAACCTCAGCACTCTGGAAGACCTGAACACCAGATGGAAGCTTCTGCAG | GTGGCCGT
       Y  N  L  S  T  L  E  D  L  N  T  R  W  K  L  L  Q   | V  A  V  -3031
60      I  T  S  A  L  W  K  T  *  T  P  D  G  S  F  C  R  |  W  P  S 
      V  *  P  Q  H  S  G  R  P  E  H  Q  M  E  A  S  A  G |   G  R   
               .         .         .         .         .         .
 9301 CGAGGACCGAGTCAGGCAGCTGCATGAAGCCCACAGGGACTTTGGTCCAGCATCTCAGCA
 6.6   E  D  R  V  R  Q  L  H  E  A  H  R  D  F  G  P  A  S  Q  H  -3051
61      R  T  E  S  G  S  C  M  K  P  T  G  T  L  V  Q  H  L  S  T 
      R  G  P  S  Q  A  A  A  *  S  P  Q  G  L  W  S  S  I  S  A   
               .            .         .         .         .         .
 9361 CTTTCTTTCCA | CGTCTGTCCAGGGTCCCTGGGAGAGAGCCATCTCGCCAAACAAAGTGCC
       F  L  S  T |   S  V  Q  G  P  W  E  R  A  I  S  P  N  K  V  P  -3071
61      F  F  P   | R  L  S  R  V  P  G  R  E  P  S  R  Q  T  K  C  P 
      L  S  F  H  |  V  C  P  G  S  L  G  E  S  H  L  A  K  Q  S  A   
               .            .         .         .         .         .
 9421 CTACTATATCAA |  CCACGAGACTCAAACAACTTGCTGGGACCATCCCAAAATGACAGAGCT   **R
 2.8   Y  Y  I  N  |   H  E  T  Q  T  T  C  W  D  H  P  K  M  T  E  L  -3091
62      T  I  S  T |    T  R  L  K  Q  L  A  G  T  I  P  K  *  Q  S  S 
      L  L  Y  Q   |  P  R  D  S  N  N  L  L  G  P  S  Q  N  D  R  A   
               .            .         .         .         .         .
 9481 CTACCAGTCTTTAG | CTGACCTGAATAATGTCAGATTCTCAGCTTATAGGACTGCCATGAA
 12    Y  Q  S  L  A |   D  L  N  N  V  R  F  S  A  Y  R  T  A  M  K  -3111
63      T  S  L   *  | L  T  *  I  M  S  D  S  Q  L  I  G  L  P  *  N 
      L  P  V  F  S  |  *  P  E  *  C  Q  I  L  S  L  *  D  C  H  E   
               .         .            .         .         .         .
 9541 ACTCCGAAGACTGCAGAAGGCCCTTTGCT | TGGATCTCTTGAGCCTGTCAGCTGCATGTGA
 2.4   L  R  R  L  Q  K  A  L  C  L |   D  L  L  S  L  S  A  A  C  D  -3131
64      S  E  D  C  R  R  P  F  A   | W  I  S  *  A  C  Q  L  H  V  M 
      T  P  K  T  A  E  G  P  L  L  |  G  S  L  E  P  V  S  C  M  *   
               .         .         .         .         .         .
 9601 TGCCTTGGACCAGCACAACCTCAAGCAAAATGACCAGCCCATGGATATCCTGCAGATTAT
 2.55  A  L  D  Q  H  N  L  K  Q  N  D  Q  P  M  D  I  L  Q  I  I  -3151
65      P  W  T  S  T  T  S  S  K  M  T  S  P  W  I  S  C  R  L  L 
      C  L  G  P  A  Q  P  Q  A  K  *  P  A  H  G  Y  P  A  D  Y   
               .         .         .         .         .         .
 9661 TAATTGTTTGACCACTATTTATGACCGCCTGGAGCAAGAGCACAACAATTTGGTCAACGT
       N  C  L  T  T  I  Y  D  R  L  E  Q  E  H  N  N  L  V  N  V  -3171
65      I  V  *  P  L  F  M  T  A  W  S  K  S  T  T  I  W  S  T  S 
      *  L  F  D  H  Y  L  *  P  P  G  A  R  A  Q  Q  F  G  Q  R   
               .         .         .         .         .            .
 9721 CCCTCTCTGCGTGGATATGTGTCTGAACTGGCTGCTGAATGTTTATGATAC | GGGACGAAC
       P  L  C  V  D  M  C  L  N  W  L  L  N  V  Y  D  T  |  G  R  T  -3191
65      L  S  A  W  I  C  V  *  T  G  C  *  M  F  M  I  R |   D  E  Q 
      P  S  L  R  G  Y  V  S  E  L  A  A  E  C  L  *  Y   | G  T  N   
               .         .         .         .         .         .
 9781 AGGGAGGATCCGTGTCCTGTCTTTTAAAACTGGCATCATTTCCCTGTGTAAAGCACATTT
 2.0   G  R  I  R  V  L  S  F  K  T  G  I  I  S  L  C  K  A  H  L  -3211
66      G  G  S  V  S  C  L  L  K  L  A  S  F  P  C  V  K  H  I  W 
      R  E  D  P  C  P  V  F  *  N  W  H  H  F  P  V  *  S  T  F   
               .            .         .         .         .         .
 9841 GGAAGACAAGTACAGAT | ACCTTTTCAAGCAAGTGGCAAGTTCAACAGGATTTTGTGACCA
       E  D  K  Y  R  Y |   L  F  K  Q  V  A  S  S  T  G  F  C  D  Q  -3231
66      K  T  S  T  D   | T  F  S  S  K  W  Q  V  Q  Q  D  F  V  T  S 
      G  R  Q  V  Q  I  |  P  F  Q  A  S  G  K  F  N  R  I  L  *  P   
               .         .         .         .         .         .
 9901 GCGCAGGCTGGGCCTCCTTCTGCATGATTCTATCCAAATTCCAAGACAGTTGGGTGAAGT
 1.45  R  R  L  G  L  L  L  H  D  S  I  Q  I  P  R  Q  L  G  E  V  -3251
67      A  G  W  A  S  F  C  M  I  L  S  K  F  Q  D  S  W  V  K  L 
      A  Q  A  G  P  P  S  A  *  F  Y  P  N  S  K  T  V  G  *  S   
               .         .         .         .         .            .
 9961 TGCATCCTTTGGGGGCAGTAACATTGAGCCAAGTGTCCGGAGCTGCTTCCAATTT | GCTAA
       A  S  F  G  G  S  N  I  E  P  S  V  R  S  C  F  Q  F   | A  N  -3271
67      H  P  L  G  A  V  T  L  S  Q  V  S  G  A  A  S  N  L  |  L  I
      C  I  L  W  G  Q  *  H  *  A  K  C  P  E  L  L  P  I  C |   *
               .         .         .         .         .         .
10021 TAATAAGCCAGAGATCGAAGCGGCCCTCTTCCTAGACTGGATGAGACTGGAACCCCAGTC
 6.8   N  K  P  E  I  E  A  A  L  F  L  D  W  M  R  L  E  P  Q  S  -3291
68      I  S  Q  R  S  K  R  P  S  S  *  T  G  *  D  W  N  P  S  P
      *  *  A  R  D  R  S  G  P  L  P  R  L  D  E  T  G  T  P  V
               .         .         .         .         .         .
10081 CATGGTGTGGCTGCCCGTCCTGCACAGAGTGGCTGCTGCAGAAACTGCCAAGCATCAGGC
       M  V  W  L  P  V  L  H  R  V  A  A  A  E  T  A  K  H  Q  A  -3311
68      W  C  G  C  P  S  C  T  E  W  L  L  Q  K  L  P  S  I  R  P
      H  G  V  A  A  R  P  A  Q  S  G  C  C  R  N  C  Q  A  S  G
               .         .         .         .            .         .
10141 CAAATGTAACATCTGCAAAGAGTGTCCAATCATTGGATTCAG | GTACAGGAGTCTAAAGCA
       K  C  N  I  C  K  E  C  P  I  I  G  F  R  |  Y  R  S  L  K  H  -3331
68      N  V  T  S  A  K  S  V  Q  S  L  D  S  G |   T  G  V  *  S  T
      Q  M  *  H  L  Q  R  V  S  N  H  W  I  Q   | V  Q  E  S  K  A
               .         .         .         .         .         .
10201 CTTTAATTATGACATCTGCCAAAGCTGCTTTTTTTCTGGTCGAGTTGCAAAAGGCCATAA
 6.8   F  N  Y  D  I  C  Q  S  C  F  F  S  G  R  V  A  K  G  H  K  -3351
69      L  I  M  T  S  A  K  A  A  F  F  L  V  E  L  Q  K  A  I  K 
      L  *  L  *  H  L  P  K  L  L  F  F  W  S  S  C  K  R  P  *   
               .         .         .            .         .         .
10261 AATGCACTATCCCATGGTGGAATATTGCACTCCG | ACTACATCAGGAGAAGATGTTCGAGA 
       M  H  Y  P  M  V  E  Y  C  T  P   | T  T  S  G  E  D  V  R  D  -3371
69      C  T  I  P  W  W  N  I  A  L  R  |  L  H  Q  E  K  M  F  E  T
      N  A  L  S  H  G  G  I  L  H  S  D |   Y  I  R  R  R  C  S  R   
               .         .         .         .         .         .
10321 CTTTGCCAAGGTACTAAAAAACAAATTTCGAACCAAAAGGTATTTTGCGAAGCATCCCCG
 1.5   F  A  K  V  L  K  N  K  F  R  T  K  R  Y  F  A  K  H  P  R  -3391
70      L  P  R  Y  *  K  T  N  F  E  P  K  G  I  L  R  S  I  P  E 
      L  C  Q  G  T  K  K  Q  I  S  N  Q  K  V  F  C  E  A  S  P   
               .         .         .         .         .            .
10381 AATGGGCTACCTGCCAGTGCAGACTGTCTTAGAGGGGGACAACATGGAAAC | TCCCGTTAC
       M  G  Y  L  P  V  Q  T  V  L  E  G  D  N  M  E  T  |  P  V  T  -3411
70      W  A  T  C  Q  C  R  L  S  *  R  G  T  T  W  K  L |   P  L  L
      N  G  L  P  A  S  A  D  C  L  R  G  G  Q  H  G  N   | S  R  Y
               .         .         .            .         .         .
10441 TCTGATCAACTTCTGGCCAGTAGATTCTGC | GCCTGCCTCGTCCCCTCAGCTTTCACACGA
 1.5   L  I  N  F  W  P  V  D  S  A  |  P  A  S  S  P  Q  L  S  H  D  -3431
71      *  S  T  S  G  Q  *  I  L  R |   L  P  R  P  L  S  F  H  T  M
      S  D  Q  L  L  A  S  R  F  C   | A  C  L  V  P  S  A  F  T  R
               .         .         .            .         .         .
10501 TGATACTCATTCACGCATTGAACATTATGCTAGCAG | GCTAGCAGAAATGGAAAACAGCAA
 2.0   D  T  H  S  R  I  E  H  Y  A  S  R  |  L  A  E  M  E  N  S  N  -3451
72      I  L  I  H  A  L  N  I  M  L  A  G |   *  Q  K  W  K  T  A  M 
      *  Y  S  F  T  H  *  T  L  C  *  Q   | A  S  R  N  G  K  Q  Q   
               .         .         .         .            .         .
10561 TGGATCTTATCTAAATGATAGCATCTCTCCTAATGAGAGCAT | AGATGATGAACATTTGTT
 1.9   G  S  Y  L  N  D  S  I  S  P  N  E  S  I  |  D  D  E  H  L  L  -3471
73      D  L  I  *  M  I  A  S  L  L  M  R  A  * |   M  M  N  I  C  * 
      W  I  L  S  K  *  *  H  L  S  *  *  E  H   | R  *  *  T  F  V   
               .         .         .         .         .         .
10621 AATCCAGCATTACTGCCAAAGTTTGAACCAGGACTCCCCCCTGAGCCAGCCTCGTAGTCC
 2.4   I  Q  H  Y  C  Q  S  L  N  Q  D  S  P  L  S  Q  P  R  S  P  -3491
74      S  S  I  T  A  K  V  *  T  R  T  P  P  *  A  S  L  V  V  L 
      N  P  A  L  L  P  K  F  E  P  G  L  P  P  E  P  A  S  *  S   
               .         .         .         .         .         .
10681 TGCCCAGATCTTGATTTCCTTAGAGAGTGAGGAAAGAGGGGAGCTAGAGAGAATCCTAGC
       A  Q  I  L  I  S  L  E  S  E  E  R  G  E  L  E  R  I  L  A  -3511
74      P  R  S  *  F  P  *  R  V  R  K  E  G  S  *  R  E  S  *  Q 
      C  P  D  L  D  F  L  R  E  *  G  K  R  G  A  R  E  N  P  S   
               .         .            .         .         .         .
10741 AGATCTTGAGGAAGAAAACAG | GAATCTGCAAGCAGAATATGACCGTCTAAAGCAGCAGCA
       D  L  E  E  E  N  R  |  N  L  Q  A  E  Y  D  R  L  K  Q  Q  H  -3531
74      I  L  R  K  K  T  G |   I  C  K  Q  N  M  T  V  *  S  S  S  T 
      R  S  *  G  R  K  Q   | E  S  A  S  R  I  *  P  S  K  A  A  A   
               .         .         .         .         .         .
10801 CGAACATAAAGGCCTGTCCCCACTGCCGTCCCCTCCTGAAATGATGCCCACCTCTCCCCA
 10    E  H  K  G  L  S  P  L  P  S  P  P  E  M  M  P  T  S  P  Q  -3551
75      N  I  K  A  C  P  H  C  R  P  L  L  K  *  C  P  P  L  P  R 
      R  T  *  R  P  V  P  T  A  V  P  S  *  N  D  A  H  L  S  P   
               .         .         .         .         .         .
10861 GAGTCCCCGGGATGCTGAGCTCATTGCTGAGGCCAAGCTACTGCGTCAACACAAAGGCCG
       S  P  R  D  A  E  L  I  A  E  A  K  L  L  R  Q  H  K  G  R  -3571
75      V  P  G  M  L  S  S  L  L  R  P  S  Y  C  V  N  T  K  A  A 
      E  S  P  G  C  *  A  H  C  *  G  Q  A  T  A  S  T  Q  R  P   
               .         .         .         .         .         .
10921 CCTGGAAGCCAGGATGCAAATCCTGGAAGACCACAATAAACAGCTGGAGTCACAGTTACA
       L  E  A  R  M  Q  I  L  E  D  H  N  K  Q  L  E  S  Q  L  H  -3591
75      W  K  P  G  C  K  S  W  K  T  T  I  N  S  W  S  H  S  Y  T 
      P  G  S  Q  D  A  N  P  G  R  P  Q  *  T  A  G  V  T  V  T   
               .         .            .         .         .         .
10981 CAGGCTAAGGCAGCTGCTGGAGCAA | CCCCAGGCAGAGGCCAAAGTGAATGGCACAACGGT
       R  L  R  Q  L  L  E  Q   | P  Q  A  E  A  K  V  N  G  T  T  V  -3611
75      G  *  G  S  C  W  S  N  |  P  R  Q  R  P  K  *  M  A  Q  R  C 
      Q  A  K  A  A  A  G  A  T |   P  G  R  G  Q  S  E  W  H  N  G   
               .         .         .         .         .         .
11041 GTCCTCTCCTTCTACCTCTCTACAGAGGTCCGACAGCAGTCAGCCTATGCTGCTCCGAGT
 10    S  S  P  S  T  S  L  Q  R  S  D  S  S  Q  P  M  L  L  R  V  -3631
76      P  L  L  L  P  L  Y  R  G  P  T  A  V  S  L  C  C  S  E  W 
      V  L  S  F  Y  L  S  T  E  V  R  Q  Q  S  A  Y  A  A  P  S   
               .         .            .         .         .         .
11101 GGTTGGCAGTCAAACTTCGGACTCCATGG | GTGAGGAAGATCTTCTCAGTCCTCCCCAGGA
       V  G  S  Q  T  S  D  S  M  G |   E  E  D  L  L  S  P  P  Q  D  -3651
76      L  A  V  K  L  R  T  P  W   | V  R  K  I  F  S  V  L  P  R  T 
      G  W  Q  S  N  F  G  L  H  G  |  *  G  R  S  S  Q  S  S  P  G   
               .         .         .         .         .         .
11161 CACAAGCACAGGGTTAGAGGAGGTGATGGAGCAACTCAACAACTCCTTCCCTAGTTCAAG
 2.0   T  S  T  G  L  E  E  V  M  E  Q  L  N  N  S  F  P  S  S  R  -3671
77      Q  A  Q  G  *  R  R  *  W  S  N  S  T  T  P  S  L  V  Q  E
      H  K  H  R  V  R  G  G  D  G  A  T  Q  Q  L  L  P  *  F  K
                  .         .         .
11221 AG | GAAGAAATACCCCTGGAAAGCCAATGAGAGAG
 3.0   G |   R  N  T  P  G  K  P  M  R  E   -3682
78       | E  E  I  P  L  E  S  Q  *  E  R
      R  |  K  K  Y  P  W  K  A  N  E  R  G
                .         .         .
         | GACACAATGTAGGAAGTCTTTTCCAC
 6.0+7.8 | D  T  M  *
79       |  T  Q  C
         |   H  N  V
               .         .         .         .         .         .
11281 ATGGCAGATGATTTGGGCAGAGCGATGGAGTCCTTAGTATCAGTCATGACAGATGAAGAA
 6.0 + 7.8
79  (3' exon)
               .         .         .         .         .         .
11341 GGAGCAGAATAAATGTTTTACAACTCCTGATTCCCGCATGGTTTTTATAATATTCATACA
               .         .         .         .         .         .
11401 ACAAAGAGGATTAGACAGTAAGAGTTTACAAGAAATAAATCTATATTTTTGTGAAGGGTA
               .         .         .         .         .         .
11461 GTGGTATTATACTGTAGATTTCAGTAGTTTCTAAGTCTGTTATTGTTTTGTTAACAATGG
               .         .         .         .         .         .
11521 CAGGTTTTACACGTCTATGCAATTGTACAAAAAAGTTATAAGAAAACTACATGTAAAATC
               .         .         .         .         .         .
11581 TTGATAGCTAAATAACTTGCCATTTCTTTATATGGAACGCATTTTGGGTTGTTTAAAAAT
               .         .         .         .         .         .
11641 TTATAACAGTTATAAAGAAAGATTGTAAACTAAAGTGTGCTTTATAAAAAAAAGTTGTTT
               .         .         .         .         .         .
11701 ATAAAAACCCCTAAAAACAAAACAAACACACACACACACACATACACACACACACACAAA
               .         .         .         .         .         .
11761 ACTTTGAGGCAGCGCATTGTTTTGCATCCTTTTGGCGTGATATCCATATGAAATTCATGG
               .         .         .         .         .         .
11821 CTTTTTCTTTTTTTGCATATTAAAGATAAGACTTCCTCTACCACCACACCAAATGACTAC
               .         .         .         .         .         .
11881 TACACACTGCTCATTTGAGAACTGTCAGCTGAGTGGGGCAGGCTTGAGTTTTCATTTCAT
               .         .         .         .         .         .
11941 ATATCTATATGTCTATAAGTATATAAATACTATAGTTATATAGATAAAGAGATACGAATT
               .         .         .         .         .         .
12001 TCTATAGACTGACTTTTTCCATTTTTTAAATGTTCATGTCACATCCTAATAGAAAGAAAT
               .         .         .         .         .         .
12061 TACTTCTAGTCAGTCATCCAGGCTTACCTGCTTGGTCTAGAATGGATTTTTCCCGGAGCC
               .         .         .         .         .         .
12121 GGAAGCCAGGAGGAAACTACACCACACTAAAACATTGTCTACAGCTCCAGATGTTTCTCA
               .         .         .         .         .         .
12181 TTTTAAACAACTTTCCACTGACAACGAAAGTAAAGTAAAGTATTGGATTTTTTTAAAGGG
               .         .         .         .         .         .
12241 AACATGTGAATGAATACACAGGACTTATTATATCAGAGTGAGTAATCGGTTGGTTGGTTG
               .         .         .         .         .         .
12301 ATTGATTGATTGATTGATACATTCAGCTTCCTGCTGCTAGCAATGCCACGATTTAGATTT
               .         .         .         .         .         .
12361 AATGATGCTTCAGTGGAAATCAATCAGAAGGTATTCTGACCTTGTGAACATCAGAAGGTA
               .         .         .         .         .         .
12421 TTTTTTAACTCCCAAGCAGTAGCAGGACGATGATAGGGCTGGAGGGCTATGGATTCCCAG
               .         .         .         .         .         .
12481 CCCATCCCTGTGAAGGAGTAGGCCACTCTTTAAGTGAAGGATTGGATGATTGTTCATAAT
               .         .         .         .         .         .
12541 ACATAAAGTTCTCTGTAATTACAACTAAATTATTATGCCCTCTTCTCACAGTCAAAAGGA
               .         .         .         .         .         .
12601 ACTGGGTGGTTTGGTTTTTGTTGCTTTTTTAGATTTATTGTCCCATGTGGGATGAGTTTT
               .         .         .         .         .         .
12661 TAAATGCCACAAGACATAATTTAAAATAAATAAACTTTGGGAAAAGGTGTAAGACAGTAG
               .         .         .         .         .         .
12721 CCCCATCACATTTGTGATACTGACAGGTATCAACCCAGAAGCCCATGAACTGTGTTTCCA
               .         .         .         .         .         .
12781 TCCTTTGCATTTCTCTGCGAGTAGTTCCACACAGGTTTGTAAGTAAGTAAGAAAGAAGGC
               .         .         .         .         .         .
12841 AAATTGATTCAAATGTTACAAAAAAACCCTTCTTGGTGGATTAGACAGGTTAAATATATA
               .         .         .         .         .         .
12901 AACAAACAAACAAAAATTGCTCAAAAAAGAGGAGAAAAGCTCAAGAGGAAAAGCTAAGGA
               .         .         .         .         .         .
12961 CTGGTAGGAAAAAGCTTTACTCTTTCATGCCATTTTATTTCTTTTTGATTTTTAAATCAT
               .         .         .         .         .         .
13021 TCATTCAATAGATACCACCGTGTGACCTATAATTTTGCAAATCTGTTACCTCTGACATCA
               .         .         .         .         .         .
13081 AGTGTAATTAGCTTTTGGAGAGTGGGCTGACATCAAGTGTAATTAGCTTTTGGAGAGTGG
               .         .         .         .         .         .
13141 GTTTTGTCCATTATTAATAATTAATTAATTAACATCAAACACGGCTTCTCATGCTATTTC
               .         .         .         .         .         .
13201 TACCTCACTTTGGTTTTGGGGTGTTCCTGATAATTGTGCACACCTGAGTTCACAGCTTCA
               .         .         .         .         .         .
13261 CCACTTGTCCATTGCGTTATTTTCTTTTTCCTTTATAATTCTTTCTTTTTCCTTCATAAT
               .         .         .         .         .         .
13321 TTTCAAAAGAAAacccaaagctctaaggtaacaaatTACCAAATTACATGAAGATTTGGT
               .         .         .         .         .         .
13381 TTTTGTCTTGCATTTTTTTCCTTTATGTGACGCTGGACCTTTTCTTTACCCAAGGATTTT
               .         .         .         .         .         .
13441 TAAAACTCAGATTTAAAACAAGGGGTTACTTTACATCCTACTAAGAAGTTTAAGTAAGTA
               .         .         .         .         .         .
13501 AGTTTCATTCTAAAATCAGAGGTAAATAGAGTGCATAAATAATTTTGTTTTAATCTTTTT
               .         .         .         .         .         .
13561 GTTTTTCTTTTAGACACATTAGCTCTGGAGTGAGTCTGTCATAATATTTGAACAAAAATT
               .         .         .         .         .         .
13621 GAGAGCTTTATTGCTGCATTTTAAGCATAATTAATTTGGACATTATTTCGTGTTGTGTTC
               .         .         .         .         .         .
13681 TTTATAACCACCGAGTATTAAACTGTAAATCATAATGTAACTGAAGCATAAACATCACAT
               .         .         .         .         .         .
13741 GGCATGTTTTGTCATTGTTTTCAGGTACTGAGTTCTTACTTGAGTATCATAATATATTGT
               .         .         .         .         .         .
13801 GTTTTAACACCAACACTGTAACATTTACGAATTATTTTTTTAAACTTCAGTTTTACTGCA
               .         .         .         .         .         .
13861 TTTTCACAACATATCAGACTTCACCAAATATATGCCTTACTATTGTATTATAGTACTGCT
               .         .         .         .  
13921 TTACTGTGTATCTCAATAAAGCACGCAGTTATGTTACAAAAAAAAAAAAAAAA

Johan den Dunnen