(intronic numbering for coding DNA Reference Sequence)
. . . . g.16774
gtaaggaccacacccgtgcctcaggtacacacatacgtgctttgac c.1359+46
--------------------- middle of intron ---------------------
g.16775 . . . . g.16819
c.1360-45 ccctcccttgataagtctcatccccagttttccctccttttctag c.1360-1
Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center