(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.264288
gtaactgtttttaaattcctctgttctcacaatttcataatattatttgatttgcaattg c.1219+60
g.264290
aa c.1219+62
--------------------- middle of intron ---------------------
g.264291 g.264291
c.1220-61 t c.1220-61
. . . . . . g.264351
actgaattacaattgaatgacatagaatgctgatttttttttctttcctttttgatacag c.1220-1
Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center