(intronic numbering for coding DNA Reference Sequence)
. . . . . g.19927
gtgtgtgccgctgctgggagcacggtggtagccttcagtgtgggctacgc c.480+50
--------------------- middle of intron ---------------------
g.19928 . . . . . g.19977
c.481-50 cctgtgccctcctgagaccaggcccctctctttgggcctgtccgctgcag c.481-1
Powered by LOVD v.2.0 Build 29
©2004-2011 Leiden University Medical Center