(intronic numbering for coding DNA Reference Sequence)
. . . . . g.115016
gtagggcgctccccctggggcgggagtgggaagggagggggtcccgcatcgtgat c.11907+55
--------------------- middle of intron ---------------------
. . . . . g.115071
ccctgatcccttctcggggattcccttcccccccacacggcactctgcctcccag c.11908-1
Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center