(intronic numbering for coding DNA Reference Sequence)
. . . . g.76258
gtgaggcctgggggctgggagacagagaggaagatttcaggggtgg c.8231+46
--------------------- middle of intron ---------------------
g.76259 . . . . g.76303
c.8232-45 agggaaccccagctccaacatctgctgaccctgtgcccccaacag c.8232-1
Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center