(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.151489
gtgtggggaggacctggctgtggggcgtgggccagcagggaccagcgtggcagtgggtgg c.14511+60
. . . . . . g.151549
tgaagggataagggccgggcagctgggctgaggaggggcaaggccaggtgcgctgagccg c.14511+120
g.151550
g c.14511+121
--------------------- middle of intron ---------------------
. . . . . . g.151610
gggtgtgtggggcagcaaggtagagccacagggactgaaccggggccaggacccagcatg c.14512-61
. . . . . . g.151670
ggcagggtggggggagggcaagcccagggcggagctgacctggccccatcctgcccccag c.14512-1
Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center