RAB7A, member RAS oncogene family (RAB7A) - coding DNA reference sequence

(used for mutation description)

(last modified January 10, 2015)

This file was created to facilitate the description of sequence variants in the RAB7A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008070.1, covering RAB7A transcript NM_004637.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5052
         acttccgctcggggcggcggcggtggcggaagtgggagcgggcctggagtct       c.-181

 .         .         .         .         .         .                g.5112
 tggccataaagcctgaggcggcggcagcggcggagttggcggcttggagagctcgggaga       c.-121

 .         .         .         .         .         .                g.5172
 gttccctggaaccagaacttggaccttctcgcttctgtcctccgtttagtctcctcctcg       c.-61

 .         .         .         .         .         .  | 02          g.74232
 gcgggagccctcgcgacgcgcccggcccggagcccccagcgcagcggccgcg | tttgaagg    c.-1

          .         .         .         .         .    | 03    .    g.76814
 ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGG | AGTCGGG    c.60
 M  T  S  R  K  K  V  L  L  K  V  I  I  L  G  D  S  G  |  V  G      p.20

          .         .         .         .         .         .       g.76874
 AAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACA       c.120
 K  T  S  L  M  N  Q  Y  V  N  K  K  F  S  N  Q  Y  K  A  T         p.40

          .         .         .         .         .         .       g.76934
 ATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAG       c.180
 I  G  A  D  F  L  T  K  E  V  M  V  D  D  R  L  V  T  M  Q         p.60

  | 04       .         .         .         .         .         .    g.85296
  | ATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGT    c.240
  | I  W  D  T  A  G  Q  E  R  F  Q  S  L  G  V  A  F  Y  R  G      p.80

          .         .         .         .         .         .       g.85356
 GCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGAT       c.300
 A  D  C  C  V  L  V  F  D  V  T  A  P  N  T  F  K  T  L  D         p.100

          .         .         .         .         .         .       g.85416
 AGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTT       c.360
 S  W  R  D  E  F  L  I  Q  A  S  P  R  D  P  E  N  F  P  F         p.120

          .         .         .          | 05        .         .    g.86428
 GTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAA | GTGGCCACAAAGCGGGCACAG    c.420
 V  V  L  G  N  K  I  D  L  E  N  R  Q   | V  A  T  K  R  A  Q      p.140

          .         .         .         .         .         .       g.86488
 GCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATC       c.480
 A  W  C  Y  S  K  N  N  I  P  Y  F  E  T  S  A  K  E  A  I         p.160

          .         .         .         .         | 06         .    g.92203
 AACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAG | GAAACGGAGGTG    c.540
 N  V  E  Q  A  F  Q  T  I  A  R  N  A  L  K  Q   | E  T  E  V      p.180

          .         .         .         .         .         .       g.92263
 GAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCC       c.600
 E  L  Y  N  E  F  P  E  P  I  K  L  D  K  N  D  R  A  K  A         p.200

          .         .                                               g.92287
 TCGGCAGAAAGCTGCAGTTGCTGA                                           c.624
 S  A  E  S  C  S  C  X                                             p.207

          .         .         .         .         .         .       g.92347
 gggggcagtgagagttgagcacagagtccttcacaaaccaagaacacacgtaggccttca       c.*60

          .         .         .         .         .         .       g.92407
 acacaattcccctctcctcttccaaacaaaacatacattgatctctcacatccagctgcc       c.*120

          .         .         .         .         .         .       g.92467
 aaaagaaaaccccatcaaacacagttacaccccacatatctctcacacacacacacacac       c.*180

          .         .         .         .         .         .       g.92527
 gcacacacacacacacagatctgacgtaatcaaactccagcccttgcccgtgatggctcc       c.*240

          .         .         .         .         .         .       g.92587
 ttggggtctgcctgcccacccacatgagcccgcgagtatggcagcaggacaagccagcgg       c.*300

          .         .         .         .         .         .       g.92647
 tggaagtcattctgatatggagttggcattggaagcttattctttttgttcactggagag       c.*360

          .         .         .         .         .         .       g.92707
 agagagaactgtttacagttaatctgtgtctaattatctgattttttttattggtcttgt       c.*420

          .         .         .         .         .         .       g.92767
 ggtctttttaccccccctttcccctccctccttgaaggctaccccttgggaaggctggtg       c.*480

          .         .         .         .         .         .       g.92827
 ccccatgccccattacaggctcacacccagtctgatcaggctgagttttgtatgtatcta       c.*540

          .         .         .         .         .         .       g.92887
 tctgttaatgcttgttacttttaactaatcagatctttttacagtatccatttattatgt       c.*600

          .         .         .         .         .         .       g.92947
 aatgcttcttagaaaagaatcttatagtacatgttaatatatgcaaccaattaaaatgta       c.*660

          .         .         .         .         .         .       g.93007
 taaattagtgtaagaaattcttggattatgtgtttaagtcctgtaatgcaggcctgtaag       c.*720

          .         .         .         .         .         .       g.93067
 gtggagggttgaaccctgtttggattgcagagtgttactcagaattgggaaatccagcta       c.*780

          .         .         .         .         .         .       g.93127
 gcggcagtattctgtacagtagacacaagaattatgtacgccttttatcaaagacttaag       c.*840

          .         .         .         .         .         .       g.93187
 agccaaaaagcttttcatctctccagggggaaaactgtctagttcccttctgtgtctaaa       c.*900

          .         .         .         .         .         .       g.93247
 ttttccaaaacgttgatttgcataatacagtggtatgtgcaatggataaattgccgttat       c.*960

          .         .         .         .         .         .       g.93307
 ttcaaaaattaaaattctcattttctttcttttttttcccccctgctccacacttcaaaa       c.*1020

          .         .         .         .         .         .       g.93367
 ctcccgttagatcagcattctactacaagagtgaaaggaaaaccctaacagatctgtcct       c.*1080

          .         .         .         .         .         .       g.93427
 agtgattttacctttgttctagaaggcgctcctttcagggttgtggtattcttaggttag       c.*1140

          .         .         .         .         .         .       g.93487
 cggagctttttcctcttttccccacccatctccccaatattgcccattattaattaacct       c.*1200

          .         .         .         .         .         .       g.93547
 ctttctttggttggaaccctggcagttctgctcccttcctaggatctgcccctgcattgt       c.*1260

          .         .         .         .         .         .       g.93607
 agcttgcttaacggagcacttctcctttttccaaaggtctacattctagggtgtgggctg       c.*1320

          .         .         .         .         .                 g.93663
 agttcttctgtaaagagatgaacgcaatgccaataaaattgaacaagaacaatgat           c.*1376

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The RAB7A, member RAS oncogene family protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.