(intronic numbering for coding DNA Reference Sequence)
. . . . g.11954
gtgagtttgagcctctggtcttgggcagtgtcctcctccatctcctt c.605+47
--------------------- middle of intron ---------------------
g.11955 . . . . g.12001
c.606-47 atgttttcctgtctcatgttaactccatttctgtcatgtctttgcag c.606-1
Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center