(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.30813
gtggagttagtggagcatggatggggcagggcctgggctgggggtgggcatttagatctc c.751+60
. g.30829
tctgtggagctttatt c.751+76
--------------------- middle of intron ---------------------
g.30830 . g.30844
c.752-75 cctttgattgtgtgc c.752-61
. . . . . . g.30904
ctggggctcttcaaaccttgctggccccatgcctccatgacaaccgcatccttccctcag c.752-1
Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center