peripheral myelin protein 22 (PMP22) - coding DNA reference sequence

(used for mutation description)

(last modified May 21, 2012)

This file was created to facilitate the description of sequence variants in the PMP22 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007949.1, covering PMP22 transcript NM_000304.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 cagttacagggagcaccaccagggaaca       c.-181

 .         .         .         .         .         .                g.5088
 tctcggggagcctggttggaagctgcaggcttagtctgtcggctgcgggtctctgactgc       c.-121

 .         .         .         .         .         .                g.5148
 cctgtggggagggtcttgccttaacatcccttgcatttggctgcaaagaaatctgcttgg       c.-61

 .         .         .      | 02  .         .         .             g.9600
 aagaaggggttacgctgtttggccgg | gcagaaactccgctgagcagaacttgccgccaga    c.-1

          .         .         .         .         .         .       g.9660
 ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTC       c.60
 M  L  L  L  L  L  S  I  I  V  L  H  V  A  V  L  V  L  L  F         p.20

          .         | 03         .         .         .         .    g.11176
 GTCTCCACGATCGTCAGC | CAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAG    c.120
 V  S  T  I  V  S   | Q  W  I  V  G  N  G  H  A  T  D  L  W  Q      p.40

          .         .         .         .         .         | 04    g.30718
 AACTGTAGCACCTCTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACG | AA    c.180
 N  C  S  T  S  S  S  G  N  V  H  H  C  F  S  S  S  P  N  E |       p.60

          .         .         .         .         .         .       g.30778
 TGGCTGCAGTCTGTCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTG       c.240
 W  L  Q  S  V  Q  A  T  M  I  L  S  I  I  F  S  I  L  S  L         p.80

          .         .         .         .         .         .       g.30838
 TTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGA       c.300
 F  L  F  F  C  Q  L  F  T  L  T  K  G  G  R  F  Y  I  T  G         p.100

          .          | 05        .         .         .         .    g.39288
 ATCTTCCAAATTCTTGCTG | GTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGG    c.360
 I  F  Q  I  L  A  G |   L  C  V  M  S  A  A  A  I  Y  T  V  R      p.120

          .         .         .         .         .         .       g.39348
 CACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGG       c.420
 H  P  E  W  H  L  N  S  D  Y  S  Y  G  F  A  Y  I  L  A  W         p.140

          .         .         .         .         .         .       g.39408
 GTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAA       c.480
 V  A  F  P  L  A  L  L  S  G  V  I  Y  V  I  L  R  K  R  E         p.160

                                                                    g.39411
 TGA                                                                c.483
 X                                                                  p.160

          .         .         .         .         .         .       g.39471
 ggcgcccagacggtctgtctgaggctctgagcgtacatagggaagggaggaagggaaaac       c.*60

          .         .         .         .         .         .       g.39531
 agaaagcagacaaagaaaaaagagctagcccaaaatcccaaactcaaaccaaaccaaaca       c.*120

          .         .         .         .         .         .       g.39591
 gaaagcagtggaggtgggggttgctgttgattgaagatgtatataatatctccggtttat       c.*180

          .         .         .         .         .         .       g.39651
 aaaacctatttataacactttttacatatatgtacatagtattgtttgctttttatgttg       c.*240

          .         .         .         .         .         .       g.39711
 accatcagcctcgtgttgagccttaaagaagtagctaaggaactttacatcctaacagta       c.*300

          .         .         .         .         .         .       g.39771
 taatccagctcagtatttttgttttgttttttgtttgtttgttttgttttacccagaaat       c.*360

          .         .         .         .         .         .       g.39831
 aagataactccatctcgccccttccctttcatctgaaagaagatacctccctcccagtcc       c.*420

          .         .         .         .         .         .       g.39891
 acctcatttagaaaaccaaagtgtgggtagaaaccccaaatgtccaaaagcccttttctg       c.*480

          .         .         .         .         .         .       g.39951
 gtgggtgacccagtgcatccaacagaaacagccgctgcccgaacctctgtgtgaagcttt       c.*540

          .         .         .         .         .         .       g.40011
 acgcgcacacggacaaaatgcccaaactggagcccttgcaaaaacacggcttgtggcatt       c.*600

          .         .         .         .         .         .       g.40071
 ggcatacttgcccttacaggtggagtatcttcgtcacacatctaaatgagaaatcagtga       c.*660

          .         .         .         .         .         .       g.40131
 caacaagtctttgaaatggtgctatggatttaccattccttattatcactaatcatctaa       c.*720

          .         .         .         .         .         .       g.40191
 acaactcactggaaatccaattaacaattttacaacataagatagaatggagacctgaat       c.*780

          .         .         .         .         .         .       g.40251
 aattctgtgtaatataaatggtttataactgcttttgtacctagctaggctgctattatt       c.*840

          .         .         .         .         .         .       g.40311
 actataatgagtaaatcataaagccttcatcactcccacatttttcttacggtcggagca       c.*900

          .         .         .         .         .         .       g.40371
 tcagaacaagcgtctagactccttgggaccgtgagttcctagagcttggctgggtctagg       c.*960

          .         .         .         .         .         .       g.40431
 ctgttctgtgcctccaaggactgtctggcaatgacttgtattggccaccaactgtagatg       c.*1020

          .         .         .         .         .         .       g.40491
 tatatatggtgcccttctgatgctaagactccagaccttttgtttttgctttgcattttc       c.*1080

          .         .         .         .         .                 g.40548
 tgattttataccaactgtgtggactaagatgcattaaaataaacatcagagtaactc          c.*1137

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Peripheral myelin protein 22 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.