(intronic numbering for coding DNA Reference Sequence)
. . . . g.44628
gtaaggctgcccggcaggccctgggccccacccagacccctcaccaa c.423+47
--------------------- middle of intron ---------------------
g.44629 . . . . g.44674
c.424-46 gccagccccgccctgtgggccgtgaccgagagcccctcgctcacag c.424-1
Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center