(intronic numbering for coding DNA Reference Sequence)
. . . . . g.12383
gtgagtggggtctgtgggggaggaagggggttccctgcttgccccctgtcc c.353+51
--------------------- middle of intron ---------------------
g.12384 . . . . . g.12433
c.354-50 cccctacacacacacaactgacaccaacacctgctttcctttctctgcag c.354-1
Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center