(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.10337
gtgagtcctgggtggcagttcctggggcagctggtgaggcctggctccaaatcccagcac c.905+60
. . . . . . g.10397
tgtggtttgccagctgtgtgaccctgagcacaacactgcacctctctgagttggtttcct c.905+120
. . . . . . g.10457
tgtctgtcgaggggatgatcccagtgtggaaggagttaaagggctctgcagacattatgt c.905+180
. g.10475
cccgtcaacagtcatcct c.905+198
--------------------- middle of intron ---------------------
g.10476 . g.10493
c.906-198 cacagtgtcccccacggc c.906-181
. . . . . . g.10553
cactccacacttgaggctgcaaaagctccctccgtaaactccggggacccagaaggaaca c.906-121
. . . . . . g.10613
gagagagggtccccagagctgcagggtctaccaggtcggcccaactgacttatgttctct c.906-61
. . . . . . g.10673
ctgccctctctctccctctcccccggcccctccattatggctgctgctgctgtggcccag c.906-1
Powered by LOVD v.2.0 Build 27
©2004-2010 Leiden University Medical Center