(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.26716
gtgagtcctctgattctggtatctggcgattctgtgcctccccagctcccattggctgtg c.1038+60
. g.26729
tccctggcagtga c.1038+73
--------------------- middle of intron ---------------------
g.26730 . g.26741
c.1039-72 aaaccagagtct c.1039-61
. . . . . . g.26801
ggcccttggttgtaggcccctggtggcccccacctccctccgtgcctctgtgtgttccag c.1039-1
Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center