(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.19915
gtgaggtgggatcgggtggcacctggaccctggcagcttcccctgccctccctttgatcc c.1505+60
. . g.19942
tttatctccccagtttggggctggggc c.1505+87
--------------------- middle of intron ---------------------
g.19943 . . g.19968
c.1506-86 tgtgacaggatgtgacagatggggtg c.1506-61
. . . . . . g.20028
ggggtaggggccttggcccatcagcctcgtttggctcaggagccacctttgcccccgcag c.1506-1
Powered by LOVD v.2.0 Build 29
©2004-2010 Leiden University Medical Center