(intronic numbering for coding DNA Reference Sequence)
. . . . g.11407
gtgcgtagtgggggagcccagggacgggctggttctgggt c.449+40
--------------------- middle of intron ---------------------
g.11408 . . . g.11446
c.450-39 ccaggctcctggcccacttgctcccctcttttgcctcag c.450-1
Powered by LOVDv.2.0-20 Build 20
©2004-2009 Leiden University Medical Center