(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.10644
gtaaggcaggggttgggtgggcacgctggcaccttcacccgacttcgtcagggaccccgc c.265+60
. . . . g.10691
tcacagggaggacctgagacctcagtcccaaccactccagcagcctt c.265+107
--------------------- middle of intron ---------------------
g.10692 . . . . g.10738
c.266-107 aggagggagaaactgttacaggtcccgaaatgggattcagattaggg c.266-61
. . . . . . g.10798
ccatcaggccaggcggggcacaccgatgccccctctgctaccgctgccccccttcccaag c.266-1
Powered by LOVDv.2.0-20 Build 20
©2004-2009 Leiden University Medical Center