(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.32559
gtcagcggggcaggggcgggtgcagcattgcggggggccgggcggggcgtgggaggcgat c.1969+60
. . g.32583
gagatgggagaagtccagacgcgt c.1969+84
--------------------- middle of intron ---------------------
g.32584 . . g.32606
c.1970-83 ccctccaacgagggcctctgcat c.1970-61
. . . . . . g.32666
ggctggggatgccccagaccccgaggcctctggcaacgacctcacgcgtgcggcttgcag c.1970-1
Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center