(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.25382
gtgagtgccccacgcggccaggaccctcccacccctcgccccgaccgctgttcccacggc c.2066+60
. g.25396
aggtcggccctgac c.2066+74
--------------------- middle of intron ---------------------
g.25397 . g.25409
c.2067-73 ccctgatcccagg c.2067-61
. . . . . . g.25469
tgggctcggccccgcggcaggcctggccccaaccggcccttcctgccctttgctatgcag c.2067-1
Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center