(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.15710
gtgagtggggcaggggcagcctgcgctgttggcctcaccatgtagctgtggacgtggcct c.1272+60
. . . . . . g.15770
ctgcggcccagtctggccctcccagcactgagagccatggcctcctgcccaagacaaatg c.1272+120
. . . . . g.15825
ggtttcttcacccacacgtccaggatgcctcttcccacagtctcagagcgggtgg c.1272+175
--------------------- middle of intron ---------------------
. . . . . g.15879
gacctggggaaccaggagattccggcctctgcaaccgtggggcatgcggtggag c.1273-121
. . . . . . g.15939
gggtggcccctcccaggggtcctgctgggggagtcagtccaggccaggcctcaagcccca c.1273-61
. . . . . . g.15999
ccccagctgggtgtgagttccagcagctgaggcttctcccctccatgtctctccactcag c.1273-1
Powered by LOVD v.2.0 Build 25
©2004-2010 Leiden University Medical Center