(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.7495
gtgagggcaggcaggacaaggctaatggtaatggtgtccgcccttccagtagttgctgag c.677+60
. g.7509
ggctggtgtcaggg c.677+74
--------------------- middle of intron ---------------------
g.7510 . g.7523
c.678-74 cctggcctgttagg c.678-61
. . . . . . g.7583
gtggctctgatcctcctctagtcactcctgctcaggacccatgctcccatacccctgtag c.678-1
Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center