(intronic numbering for coding DNA Reference Sequence)
. . . . g.23835
gtatggcgcagccaccacactctctccttcctgactccttggctttc c.1153+47
--------------------- middle of intron ---------------------
g.23836 . . . . g.23882
c.1154-47 tccttcagtgtctgggtctgacccctgcattccccttttggctgcag c.1154-1
Powered by LOVD v.2.0 Build 34
©2004-2013 Leiden University Medical Center