(intronic numbering for coding DNA Reference Sequence)
. . . . . . g.23355
gtcgaaaggggcaaggacccccttttgtccctttgatctttgtgggtggtcaggggtatg c.1005+60
g.23364
ttggggatt c.1005+69
--------------------- middle of intron ---------------------
g.23365 g.23373
c.1006-69 aaggcatga c.1006-61
. . . . . . g.23433
gggtcctgattgttagtgagggaagtcagtcctggctgctcagtagtttttcctccacag c.1006-1
Powered by LOVD v.2.0 Build 34
©2004-2013 Leiden University Medical Center