(intronic numbering for coding DNA Reference Sequence)
. . . . . g.34386
gtgagtcccttggagggtggtgtggccccgaccccggccctttggggtcccggtgta c.4514+57
--------------------- middle of intron ---------------------
. . . . . g.34443
cgaggtggctttgcctgtggcccctgagccctgacccggtgtccctcctggtggcag c.4515-1
Powered by LOVDv.2.0-23 Build 23
©2004-2010 Leiden University Medical Center