Leiden Muscular Dystrophy pages©

PCR details (CA)n-repeats

(modified last October 4, 1998)

Contents

5'DYS-II

5'DYS-II data have been contributed to these pages by Sylvie Tuffery (as published in Tuffery et al.).

1. Marker details

Localization 1.2 kb 5' dystrophin Dp427c exon 1
DXS-number DXS1242
GenBank L01538
Variable sequence (CA)23
GDB ...
Original Reference Feener
Heterozygosity frequency 0.63
PIC-value 0.82
Number of alleles found 9
Length most frequent allele 206 bp
Length variation alleles 206-228 bp

2. Primer details

  Name Sequence
Forward primer 5'-DysII tcttgatatatagggattatttgtgtttgttatac
Reverse primer 3'-DysII attatgaaactataaggaataactcatttagc

3. Allele frequencies

Length
(in bp)		 Frequency Sequence
228 0.04  
224 0.07  
222 0.09  
218 0.09 (CA)20
216 0.22 (CA)19
212 0.03  
208 0.16  
206 0.26  
other 0.05  

NOTE: frequencies determined on ... chromosomes.

4. PCR-conditions

Co-amplified in a duplex reaction with TG15 in the presence of fluorescent (R110)dUTP (Applied Biosystems) for internally labelling.

PCR ingredients

Component PCR-reaction
name concentration stock final concentration amount in ”l
autoclaved water - - 15.4
SuperTaq buffer 10 * buffer 1 * buffer 2.5
dNTP's 2 mM 0.2 mM 2.5
primer mix 25 ”M of each primer 0.5 ”M 0.5
MgCl2 25 mM - -
DMSO 100 % - -
BSA 10 mg/ml - -
Taq-polymerase 5U/”l 0.5 U 0.1
alpha-32P-dCTP 1”Ci/”l - -
DNA template 50 ng/”l 200 ng 4
final volume PCR 25

PCR-cycling

PCR step temperature in șC time in sec. number of cycli
denaturation template 95 300 1
denaturation 94 30 30
annealing 55 30
elongation 72 30
final elongation 72 300 1
store 4

STR44

STR44 data have been contributed to these pages by Sylvie Tuffery (as published in Tuffery et al.).

Localization 13.8 kb 3' dystrophin exon 44
DXS-number DXS1238
GenBank M81257
Variable sequence (...CA)n
GDB ...
Original Reference Clemens
Heterozygosity frequency 0.57
PIC-value 0.89
Number of alleles found > 10
Length most frequent allele 192 bp
Length variation alleles 180-200 bp

2. Primer details

  Name Sequence
Forward primer   tccaacattggaaatcacatttcaa
Reverse primer   tcatcacaaatagatgtttcacag

3. Allele frequencies

Length
(in bp)		 Frequency Sequence
200 0.05  
196 0.02  
194 0.10  
192 0.28  
190 0.05  
188 0.10  
186 0.07  
184 0.10  
180 0.05  
other 0.02  

NOTE: frequencies determined on ... chromosomes.

4. PCR-conditions

Co-amplified in a duplex reaction with STR45 in the presence of ......fluorescent (R110)dUTP (Applied Biosystems) for internally labelling.

STR45

| Top of page | PCR-able (CA)n-repeats | LMDp homepage |
| Remarks / information | Copyright©, liability |