(last modified September 24, 2004)
The Protein Truncation Test for point mutation detection in the EMD-gene (Emery-Dreifuss Muscular Dystrophy) has been published as;
EMD entry in OMIM / EMD entry LocusLink
RNA was purified from peripheral blood lymphocytes or from cultured Epstein-Barr virus transformed lymphoblastoid cell lines following standard procedures{ref}.
One µg total RNA was reverse transcribed in a 60 µl reaction, with 400 U Superscript II RT in 5*First Strand Buffer (Gibco BRL), using 1 µg random hexamer primers (Promega), 0.01M DTT, 1 mM dNTP's and 40 U RNasin at 42ºC for 1 h. 5 µl of the cDNA reaction was used for a first round PCR amplification. PCR conditions: 0.5 µM of each dNTP's, 15 pmol of each primer (Em2F-T7 and Em2R), 0.75mM MgCl2, 10*buffer 3 (Expand long template kit, Boehringer Mannheim), 0.75 µl enzyme mix (Expand long template kit) in 25 µl final volume. PCR was for 2 min. at 94ºC, followed by 35 cycles of 30 sec. at 94ºC, 30 sec. at 64ºC, 1 min. at 72ºC and a final elongation of 7 min. at 72ºC. 0.1 µl of this PCR reaction was used in a second round PCR amplification. PCR conditions: 0.2 µM of each dNTP's, 3.5 pmol of each primer (Em1F-T7 and Em1R-M13), 2 mM MgCl2, 10*buffer (Perkin Elmer), 2 U Taq polymerase (Perkin Elmer) in 50 µl final volume. PCR was for 2 min. at 94 ºC, followed by 28 cycles of 30 sec. at 94ºC, 30 sec. at 64ºC, 1 min. at 72ºC and a final elongation of 7 min. at 72 ºC.
| Name | Location | Sequence | 
|---|---|---|
| Em2F-T7 | 2 - 22 | T7-GGCCGGTTTTGGTAGGCCCGG | 
| Em1F | 39 - 57 | T7-CGCCTGAGCCCGCACCCGC | 
| Em1R-M13 | 875 - 895 | M13-CCCACTGCTAAGGCAGTCAGC | 
| Em2R | 959 - 979 | GGGGAGCAAGCACTACTCTGG | 
Legend:
Name: laboratory primer name. Location: Location of primer on the emerin
cDNA-sequence (accession nr M...., GenBank). Sequence: primer sequence, T7- = ...,
M13- = .... 
General protocol from Leiden including SDS-PAGE analysis of translation products, electro blotting, detection of proteins, interpretation, protein marker, estimation of the part of the PTT fragment to be sequenced and troubleshooting.
| Top of page | EMD mutation database |
EMD entry
LocusLink |
|  PTT home page | LMDp homepage |
| Remarks / information | Copyright©,
liability |