(last modified on October 11, 2001)
Most data provided on this page are derived from the paper of Bolanos-Jimenez (2001).
The DMD-gene in zebra fish (Brachydanio rerio) has not been characterized yet. Using radiation hybrid mapping, the gene was mapped to linkage group 1, between markers z5508 and z5058 (1.3 cM apart, Balanos-Jimenez). It is not known yet whether this linkage group (chromosome) carries the sexual characters in zebra fish, although other known human X-gene orthologues do not map to this linkage group.
The paper of Balanos-Jimenez is based mainly on the characterization of one transcript probably derived from a Dp427-like transcript (spanning 3.5 kb with a 3.3 kb open reading frame). Expression of the DMD-gene was detected in all tissues tested (muscle, brain, heart, eye, intestine).
Using 5'-RACE, Bolanos-Jimenez (2001) specifically identified and characterized the zebra fish Dp71-transcript. Using RT-PCR, a strong signal could be detected in brain and eyes, a less intense signal in heart and intestine and no signal in skeletal muscle. Like in human, this transcript diverges from the full length transcript directly upstream from (human) exon 63. Interestingly, like in human and mouse, this transcripts encodes a unique 7 amino acid N-terminal sequence (MRENLRN versus MRE[Q/H]LKG).
Bolanos-Jimenez (2001) detected extensive differential splicing in the 3'-terminal half of the DMD-gene, largely mimicking that found in human and mouse. Adult brain, heart and muscle contained transcripts lacking exon 71. In addition, adult heart and muscle contained transcripts lacking exon 73 (note that also the original cDNA clone isolated from 20-40 h zebra fish embryos lacked exon 73). No alternative splicing could be detected between exons 59-69, except for brain whcih contained a Dp71-transcript lacking exons 66-68.
| Transcript | Length (in bp) |
Forward | Reverse | Reference |
| dystrophin 3'-end |
876 | CGTAAAGAAGTGGAGGATGTAACG | TAGGGTACGAATCTTCCCAGCTCG | Bolanos-Jimenez |
| Dp71 | 401 | CACAGTAGAGAGGAACACCGCGA | GCTGTGCTGCTGCTCCAGACGGTC | Bolanos-Jimenez |
A - different in seuqnece from Bolanos-Jimenez.
....