(last modified February 12, 2006)
Links to other databases:
Gene
Symbol nomenclature LocusLink OMIM Gene Map
GDB
The LGMB-2G locus was mapped to chromosome 17q11-12 in two Brazilian families. Ultimately, the region confined to a 3-cM region between markers D17S1867 and D17S1814 (Moreira et al.). Moreira et al. constructed a BAC/PAC contig across this region, identified new polymorphic markers (CA-repeats) in this region and used these to refine the localization of the disease locus). In two of the three available families, they noticed homozygosity of the region. Together, these data refined the locailization of the gene to a 1.2 Mb region between D17S1851 and D17S1814 on 17q12. The telethonin gene (Gene Symbol TCAP, titin-cap), which is predominantly expressed in striated muscle (Valle et al.), mapped in this region on BAC62N23, making it a prime candidate.
The TCAP gene is rather small two-exon gene, spanning 1.2 kb. The TCAP gene is flanked directly 5' (1.9 kb, centromeric) by the STARD3. Directly 3' are the PNMT (phenylethanolamine N-methyltransferase) and PERLD1 (per1-like domain containing 1) genes. Except for PERLD1, the genes have the same transcriptional orientation, from centromere to telomere.
| Exon | Exon size (bp) | Intron size (kb) | 5' cDNA position | Splice after | Remarks |
|---|---|---|---|---|---|
| 1 | 125 | 246 | -15 | 2 | 15 nt 5' UTR, ATG-codon |
| 2 | 839 | - | 111 | - | binding sites for CSRP3 (aa 53-81), TTN (aa 78-125), MINK (aa
160-167) 445 nt 3'UTR |
Legend:
Exon: numbering of exons and intron/exon boundaries are according to
sequence analysis with the
first base of the Met-codon counted as position 1 (see coding
DNA Reference
Sequence). Exon size: size of exon indicated in basepairs. Intron size:
size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon
(according to coding DNA Reference
Sequence). Splice after: splicing occurs in
between of two coding triplets (0), after the first (1) or the second (2) base of a
triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region.
Links to other databases: UniGene: Hs.111110 RefSeq: NM_003673
On Northern-blot, telethonin RNA expression wa....
Most TCAP transcripts contain a very short 5' UTR, containing 15 nucleotides only. The EST databases contain few cDNA's that extend further upstream, up to 1173 nucleotides (5' cap clone AK096328). Transcripts of the upstream STARD3 gene terminate only 1.9 kb 5' of the TCAP transription start site..
Links to other databases: RefSeq: NP_003664
Telethonin is exclusively found in striated and cardiac muscle (Valle et al.). Recent data suggest that it is localized to the Z disc of adult skeletal muscle (Moreira) and cultured myocytes (Mues). On Western blot, telethonin appears as a 19 kDalton protein (Valle et al.). Histochemical analysis of muscle samples shows a sarcomeric staining.
Telethonin is a substrate of titin, a molecular ruler for the assembly of the sarcomere by providing spatially defined binding sites for other sarcomeric proteins (Gregorio). Titin becomes activated by phosphorylation and calmodulin binding and phosphorylates the carboxy-terminal domain of telethonin in early differentiating myocytes (Mayans).
CSRP3 (CSRP3 encoded muscle LIM protein [MLP], aa 53-81), TTN (aa 78-125), MINK (aa 160-167)
Valle et al. describe a polyclonal mouse anti-telethonin antibody raised against against a recombinant telethonin fragment covering 128 C-terminal amino acids The antibody gives clear staining in immunohistochemistry and on Western blot (19 kDalton protein).
Links to other databases: OMIM: 601954 (LGMD-2G), 607487 (CMD-1N), 192600 (CMH)
LGMD-2G, CMD-1N, CMH
Limb-girdle muscular dystrophy type 2G is a relatively mild form of autosomal recessive LGMD. The LGMB-2G locus was mapped to chromosome 17q11-12 in two Brazilian families. Moreira et al. analysed the telethonin gene for the presence of mutations and identified two independent mutations in the three LGMD-2G families.
Mutations in telethonin are suggested to alter sarcomeric structure (Moreira).
Telethonin sequence variations (mutations and polymorphisms)
| Amplified | Length | forward primer | reverse primer | Name | Reference |
|---|---|---|---|---|---|
| exon 1 | 295 | ccccattagtgagtcttggc | gctcagtgagggtgctctg | TELE-1F/1R | Moreira |
| exon 2 | 568 | agagagcaacagctcccagg | acaggtcctagccaggaagg | TELE-2F/2R | Moreira |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to Moreira (GenBank
AJ010063) Length: length of PCR-product in basepairs. Forward primer:
sequence of forward primer. Reverse primer: sequence of reverse primer. Name:
name of the primers. Reference: publication describing the primer(s).
none reported
| Amplified | Length | Forward primer | Reverse primer | Name | Reference |
|---|---|---|---|---|---|
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified (cDNA sequence from GenBank
AJ011098). Length: length of PCR-product in basepairs. Reference:
publication describing the primer(s). Forward primer: sequence of forward primer. Reverse
primer: sequence of reverse primer. Name: name of the primers.
| Top of page | LMDp homepage |
| Muscular dystrophies |
| Remarks / information | Disclaimer
|