Leiden Muscular Dystrophy pages

Telethonin (TCAP)

( LGMD-2G, CMD-1N, CMH )

(last modified February 12, 2006)


Contents



Summary


 


The telethonin gene


Links to other databases:
Gene Symbol nomenclature   LocusLink    OMIM Gene Map   GDB

The LGMB-2G locus was mapped to chromosome 17q11-12 in two Brazilian families. Ultimately, the region confined to a 3-cM region between markers D17S1867 and D17S1814 (Moreira et al.). Moreira et al. constructed a BAC/PAC contig across this region, identified new polymorphic markers (CA-repeats) in this region and used these to refine the localization of the disease locus). In two of the three available families, they noticed homozygosity of the region. Together, these data refined the locailization of the gene to a 1.2 Mb region between D17S1851 and D17S1814 on 17q12. The telethonin gene (Gene Symbol TCAP, titin-cap), which is predominantly expressed in striated muscle (Valle et al.), mapped in this region on BAC62N23, making it a prime candidate.

The TCAP gene is rather small two-exon gene, spanning 1.2 kb. The TCAP gene is flanked directly 5' (1.9 kb, centromeric) by the STARD3. Directly 3' are the PNMT (phenylethanolamine N-methyltransferase) and PERLD1 (per1-like domain containing 1) genes. Except for PERLD1, the genes have the same transcriptional orientation, from centromere to telomere.

Exon Exon size (bp) Intron size (kb) 5' cDNA position Splice after Remarks
1 125 246 -15 2 15 nt 5' UTR, ATG-codon
2 839 - 111 - binding sites for CSRP3 (aa 53-81), TTN (aa 78-125), MINK (aa 160-167)

445 nt 3'UTR

Legend:
Exon: numbering of exons and intron/exon boundaries are according to sequence analysis with the first base of the Met-codon counted as position 1 (see coding DNA Reference Sequence). Exon size: size of exon indicated in basepairs. Intron size: size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon (according to coding DNA Reference Sequence). Splice after: splicing occurs in between of two coding triplets (0), after the first (1) or the second (2) base of a triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region.

primers for DNA-amplification


The telethonin mRNA


Links to other databases:     UniGene: Hs.111110    RefSeq: NM_003673

On Northern-blot, telethonin RNA expression wa....

Most TCAP transcripts contain a very short 5' UTR, containing 15 nucleotides only. The EST databases contain few cDNA's that extend further upstream, up to 1173 nucleotides (5' cap clone AK096328). Transcripts of the upstream STARD3 gene terminate only 1.9 kb 5' of the TCAP transription start site..

primers for RNA-amplification


The telethonin protein


Links to other databases:   RefSeq: NP_003664

Telethonin is exclusively found in striated and cardiac muscle (Valle et al.). Recent data suggest that it is localized to the Z disc of adult skeletal muscle (Moreira) and cultured myocytes (Mues). On Western blot, telethonin appears as a 19 kDalton protein (Valle et al.). Histochemical analysis of muscle samples shows a sarcomeric staining.

Telethonin is a substrate of titin, a molecular ruler for the assembly of the sarcomere by providing spatially defined binding sites for other sarcomeric proteins (Gregorio). Titin becomes activated by phosphorylation and calmodulin binding and phosphorylates the carboxy-terminal domain of telethonin in early differentiating myocytes (Mayans).

CSRP3 (CSRP3 encoded muscle LIM protein [MLP], aa 53-81), TTN (aa 78-125), MINK (aa 160-167) 

telethonin antibodies

Valle et al. describe a polyclonal mouse anti-telethonin antibody raised against against a recombinant telethonin fragment covering 128 C-terminal amino acids The antibody gives clear staining in immunohistochemistry and on Western blot (19 kDalton protein).


Telethonin and disease: LGMD-2G, CMD-1N, CMH


Links to other databases:   OMIM:   601954 (LGMD-2G),   607487 (CMD-1N),   192600 (CMH)

LGMD-2G, CMD-1N, CMH

Limb-girdle muscular dystrophy type 2G is a relatively mild form of autosomal recessive LGMD. The LGMB-2G locus was mapped to chromosome 17q11-12 in two Brazilian families. Moreira et al. analysed the telethonin gene for the presence of mutations and identified two independent mutations in the three LGMD-2G families.

Mutations in telethonin are suggested to alter sarcomeric structure (Moreira).

Telethonin sequence variations (mutations and polymorphisms)


Miscellaneous


DNA-primers

Amplified Length forward primer reverse primer Name Reference
exon 1 295 ccccattagtgagtcttggc gctcagtgagggtgctctg TELE-1F/1R Moreira
exon 2 568 agagagcaacagctcccagg acaggtcctagccaggaagg TELE-2F/2R Moreira

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to Moreira (GenBank AJ010063) Length: length of PCR-product in basepairs. Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Name: name of the primers. Reference: publication describing the primer(s).


RNA-primers

none reported

Amplified Length Forward primer Reverse primer Name Reference
           

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified (cDNA sequence from GenBank AJ011098). Length: length of PCR-product in basepairs. Reference: publication describing the primer(s). Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Name: name of the primers.


telethonin sequences





| Top of page | LMDp homepage |
| Muscular dystrophies |
| Remarks / information | Disclaimer |