Titin (TTN) - 2119 nt intron 122 reference sequence

(intronic numbering for coding DNA Reference Sequence)

Contains suggested "exon 123" (Bang et al. (2001)


         .         .         .         .         .         .  g.143847
gtacgccagagccaatgatggggagactctttgctccaagtgccagccttttgctttcta  c.31762+60

         .         .         .         .         .         .  g.143907
cgatcttcatatgtactatgctgcctttgtcttttgtctcttttacattcttcttgtgtt  c.31762+120

         .         .         .         .         .         .  g.143967
tttactgtttgtcagcttccgtgccatgctcttgacatactttatttattatactgaata  c.31762+180

         .         .         .         .         .         .  g.144027
ttcctaagacatcaccaaaaagtattgttaaaggaagtaactatgtcaaactgctatctt  c.31762+240

         .         .         .         .         .         .  g.144087
acatttttaatatcttccctcttttagagaaagaggaaatgtttgtgaaacttgttttct  c.31762+300

         .         .         .         .         .         .  g.144147
actgacatgtttctaggaaaaaacctttcatccttcataaatgtaactttttcttaataa  c.31762+360

         .         .         .         .         .         .  g.144207
aagcagtttcatgcattatgaagaggtggagacaggcaatgacaactggagagtgtctgg  c.31762+420

         .         .         .         .         .         .  g.144267
cagaactgaatgttaattacataaagacgtacatagtaccacgcttcttaaaagtcaata  c.31762+480

         .         .         .         .         .         .  g.144327
gtggcgagtcttcaatagtggggaacatacagattttttgaagtttactttcaccatttt  c.31762+540

         .         .         .         .         .         .  g.144387
cttgagaccttaactgagcttcagtatttgccataaatgtttccgttatctaattagcta  c.31762+600

         .         .         .         .         .         .  g.144447
gtcaaagtacctttcacagaggtatgtttgaatgaaaatgtgctgctgtggtatatcaca  c.31762+660

         .         .         .         .         .         .  g.144507
aatcccttgctttggtttgtttgggatttttttggcgataaaaggcactatcttattgaa  c.31762+720

         .         .         .         .         .         .  g.144567
gcactgaagctacaattgcacgcatccattcagttatagagagactcagcaagaattcaa  c.31762+780

         .         .         .         .         .         .  g.144627
cattatccaatttaggagaaaccagacctaactaaaatagtacattttgaatagtgttcc  c.31762+840

         .         .         .         .         .         .  g.144687
cttggcctgactttgcaatgtttctattttcttcctgaatcaaatatgcttctctctttc  c.31762+900

         .         .         .         .         .         .  g.144747
tcaaactcttggctctttcaaaattcttttgattatctaaccattaaatacaaaggtcat  c.31762+960

         .         .         .         .         .         .  g.144807
gttagtaaaaccaatactaatactaaagctacttgagacagatcgtcttagataaattaa  c.31762+1020

         .         .         .         .  g.144847
atccattgttattatgtactacatttccccatacaaagca  c.31762+1060

--------------------- middle of intron ---------------------
       g.144848               .         .         .           g.144886
       c.31763-1059  taaagaaccttttctatatactatctgaacattcttgac  c.31763-1021

.         .         .         .         .         .           g.144946
tgtttgtgtaatcactaattcgttttcagcaaagtcatatatgtcttctaaaggagacac  c.31763-961

.         .         .         .         .         .           g.145006
agaggcatctctcatttactcataaaaacaaatacacatagtataatagcacgtatatat  c.31763-901

.         .         .         .         .         .           g.145066
atataaatactgcatgtatatatagcataacatatacatatataaattaacagctatata  c.31763-841

.         .         .         .         .         .           g.145126
attgcaccaaaatattacaaatgcacgtgcagaggtgcagggattcacaaaagctgccaa  c.31763-781

.         .         .         .         .         .           g.145186
tattgtatttaaaatgagaacaattattgccaataatgcatgctgttaaaattcatcttc  c.31763-721

.         .         .         .         .         .           g.145246
caattaaaaagtcaacattatccattcttagaatagataaatcaaatacactgtaaacat  c.31763-661

.         .         .         .         .         .           g.145306
tttttaggttgaaaaccctgttcaaaactctagagccccttagaaaaaaaaagcacaaat  c.31763-601

.         .         .         .         .         .           g.145366
acacatacccacaaaattctgcacacaaagctctgtaaagtcattaacacatgggtatca  c.31763-541

.         .         .         .         .          | .           g.145426
gattgagagacctactctagagtgtttcctgagttttgaattcactacag | gcacaccccc  c.31763-481
                                                 G |   T  P  P
                   exon 123 in Bang et al. (2001)  ^ lacks experimental proof

.         .         .         .  |         .         .           g.145486
caaaaatgagaggagaaatgtggggaagagaa | gtaagttacacatattcaactattctaa  c.31763-421
 K  N  E  R  R  N  V  G  K  R  S | 

.         .         .         .         .         .           g.145546
gacttcttagtcttagtctaaaatagtcttagataaactaaagccattgttattaagtac  c.31763-361

.         .         .         .         .         .           g.145606
tccatttctcaatacaaagcgtaaagaagttttctatataccatatccacattcttgatt  c.31763-301

.         .         .         .         .         .           g.145666
gtttgtgtcatcactaatttgtttttagcaaggtcatacaatatataaaggatgaattct  c.31763-241

.         .         .         .         .         .           g.145726
gtgcacaactttgttacataactcatttttgcctaaatgcctctaaaacattatttgtga  c.31763-181

.         .         .         .         .         .           g.145786
tatttatcacattgtgatccttggaatagtatagttagtttaattttctggataattttg  c.31763-121

.         .         .         .         .         .           g.145846
ctgatgcatagataatccataacaacattaatgtactacataaagatttgtgcatgtgcc  c.31763-61

.         .         .         .         .         .           g.145906
tatgttctttcataaaagtgatatatgtctgaactaacattgtgtttcaaaaactttaag  c.31763-1


Powered by LOVD v.2.0 Build 35
2004-2013 Leiden University Medical Center