Tripartite motif-containing 32 (TRIM32) - coding DNA reference sequence

(used for mutation description)

(last modified August 28, 2009)


This file was created to facilitate the description of sequence variants in the TRIM32 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_011619.1, covering TRIM32 transcript NM_012210.3. Exon 2 is alternatively spliced producing transcript variant 2 (NM_001099679.1).
NOTE: a previous reference sequence included an extra exon between exons 1 and 2 (see alternatively spliced exon). Since this exon is only present in rare transcripts and seems not evolutionary conserved we have removed it from the reference sequence.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.5041
                    ggtgctcaacggcgcgtgcgcagagggaggcaggcgggtgg       c.-121

 .         .         .         .         | 02           .             g.15381
 gctgccggcggtggactcgtcggagccgcgggcggtcag | cag  gaatttgaccctctaggg    c.-61
                                                ^ alternative splice site

 .         .         .         .         .         .                g.15441
 catgaatactgtgctgttcagttctgagctgtgctagcaatacccttcaaaggaagagca       c.-1

          .         .         .         .         .         .       g.15501
 ATGGCTGCAGCAGCAGCTTCTCACCTGAACCTGGATGCCCTCCGGGAAGTGCTAGAATGC       c.60
 M  A  A  A  A  A  S  H  L  N  L  D  A  L  R  E  V  L  E  C         p.20

          .         .         .         .         .         .       g.15561
 CCCATCTGCATGGAGTCCTTCACAGAAGAGCAGCTGCGTCCCAAGCTTCTGCACTGTGGC       c.120
 P  I  C  M  E  S  F  T  E  E  Q  L  R  P  K  L  L  H  C  G         p.40

          .         .         .         .         .         .       g.15621
 CATACCATCTGCCGCCAGTGCCTGGAGAAGCTATTGGCCAGTAGCATCAATGGTGTCCGC       c.180
 H  T  I  C  R  Q  C  L  E  K  L  L  A  S  S  I  N  G  V  R         p.60

          .         .         .         .         .         .       g.15681
 TGTCCCTTTTGCAGCAAGATTACCCGCATAACCAGCTTGACCCAGCTGACAGACAATCTG       c.240
 C  P  F  C  S  K  I  T  R  I  T  S  L  T  Q  L  T  D  N  L         p.80

          .         .         .         .         .         .       g.15741
 ACAGTGCTAAAGATCATTGATACAGCTGGGCTCAGCGAGGCTGTGGGGCTGCTCATGTGT       c.300
 T  V  L  K  I  I  D  T  A  G  L  S  E  A  V  G  L  L  M  C         p.100

          .         .         .         .         .         .       g.15801
 CGGTCCTGTGGGCGGCGTCTGCCCCGGCAATTCTGCCGGAGCTGTGGTTTGGTGTTATGT       c.360
 R  S  C  G  R  R  L  P  R  Q  F  C  R  S  C  G  L  V  L  C         p.120

          .         .         .         .         .         .       g.15861
 GAGCCCTGCCGGGAGGCAGACCATCAGCCTCCTGGCCACTGTACACTCCCTGTCAAAGAA       c.420
 E  P  C  R  E  A  D  H  Q  P  P  G  H  C  T  L  P  V  K  E         p.140

          .         .         .         .         .         .       g.15921
 GCAGCTGAGGAGCGGCGTCGGGACTTTGGAGAGAAGTTAACTCGTCTGCGGGAACTTATG       c.480
 A  A  E  E  R  R  R  D  F  G  E  K  L  T  R  L  R  E  L  M         p.160

          .         .         .         .         .         .       g.15981
 GGGGAGCTGCAGCGGCGGAAGGCAGCCTTGGAAGGTGTCTCCAAGGACCTTCAGGCAAGG       c.540
 G  E  L  Q  R  R  K  A  A  L  E  G  V  S  K  D  L  Q  A  R         p.180

          .         .         .         .         .         .       g.16041
 TATAAAGCAGTTCTCCAGGAGTATGGGCATGAGGAGCGCAGGGTCCAGGATGAGCTGGCT       c.600
 Y  K  A  V  L  Q  E  Y  G  H  E  E  R  R  V  Q  D  E  L  A         p.200

          .         .         .         .         .         .       g.16101
 CGCTCTCGGAAGTTCTTCACAGGCTCTTTGGCTGAAGTTGAGAAGTCCAATAGTCAAGTG       c.660
 R  S  R  K  F  F  T  G  S  L  A  E  V  E  K  S  N  S  Q  V         p.220

          .         .         .         .         .         .       g.16161
 GTAGAGGAGCAGAGTTACCTGCTTAACATTGCAGAGGTGCAGGCTGTGTCTCGCTGTGAC       c.720
 V  E  E  Q  S  Y  L  L  N  I  A  E  V  Q  A  V  S  R  C  D         p.240

          .         .         .         .         .         .       g.16221
 TACTTCCTGGCCAAGATCAAGCAGGCAGATGTAGCACTACTGGAGGAGACAGCTGATGAG       c.780
 Y  F  L  A  K  I  K  Q  A  D  V  A  L  L  E  E  T  A  D  E         p.260

          .         .         .         .         .         .       g.16281
 GAGGAGCCAGAGCTCACTGCCAGCTTGCCTCGGGAGCTCACCCTGCAAGATGTGGAGCTC       c.840
 E  E  P  E  L  T  A  S  L  P  R  E  L  T  L  Q  D  V  E  L         p.280

          .         .         .         .         .         .       g.16341
 CTTAAGGTAGGTCATGTTGGCCCCCTCCAAATTGGACAAGCTGTTAAGAAGCCCCGGACA       c.900
 L  K  V  G  H  V  G  P  L  Q  I  G  Q  A  V  K  K  P  R  T         p.300

          .         .         .         .         .         .       g.16401
 GTTAACGTGGAAGATTCCTGGGCCATGGAGGCCACAGCGTCTGCTGCCTCTACCTCTGTT       c.960
 V  N  V  E  D  S  W  A  M  E  A  T  A  S  A  A  S  T  S  V         p.320

          .         .         .         .         .         .       g.16461
 ACTTTTAGAGAGATGGACATGAGCCCGGAGGAAGTGGTTGCCAGCCCTAGGGCCTCACCT       c.1020
 T  F  R  E  M  D  M  S  P  E  E  V  V  A  S  P  R  A  S  P         p.340

          .         .         .         .         .         .       g.16521
 GCTAAACAGCGGGGTCCTGAGGCAGCCTCCAATATCCAGCAGTGCCTCTTTCTCAAGAAG       c.1080
 A  K  Q  R  G  P  E  A  A  S  N  I  Q  Q  C  L  F  L  K  K         p.360

          .         .         .         .         .         .       g.16581
 ATGGGGGCCAAAGGCAGCACTCCAGGAATGTTCAATCTTCCAGTCAGTCTCTACGTGACC       c.1140
 M  G  A  K  G  S  T  P  G  M  F  N  L  P  V  S  L  Y  V  T         p.380

          .         .         .         .         .         .       g.16641
 AGTCAAGGTGAAGTACTAGTCGCTGACCGTGGTAACTATCGTATACAAGTCTTTACCCGC       c.1200
 S  Q  G  E  V  L  V  A  D  R  G  N  Y  R  I  Q  V  F  T  R         p.400

          .         .         .         .         .         .       g.16701
 AAAGGCTTTTTGAAGGAAATCCGCCGCAGCCCCAGTGGCATTGATAGCTTTGTGCTAAGC       c.1260
 K  G  F  L  K  E  I  R  R  S  P  S  G  I  D  S  F  V  L  S         p.420

          .         .         .         .         .         .       g.16761
 TTCCTTGGGGCAGATCTACCCAACCTCACTCCTCTCTCAGTGGCAATGAACTGCCAGGGG       c.1320
 F  L  G  A  D  L  P  N  L  T  P  L  S  V  A  M  N  C  Q  G         p.440

          .         .         .         .         .         .       g.16821
 CTGATTGGTGTGACTGACAGCTATGATAACTCCCTCAAGGTATATACCTTGGATGGCCAC       c.1380
 L  I  G  V  T  D  S  Y  D  N  S  L  K  V  Y  T  L  D  G  H         p.460

          .         .         .         .         .         .       g.16881
 TGCGTGGCCTGTCACAGGAGCCAGCTGAGCAAACCATGGGGTATCACAGCCTTGCCATCT       c.1440
 C  V  A  C  H  R  S  Q  L  S  K  P  W  G  I  T  A  L  P  S         p.480

          .         .         .         .         .         .       g.16941
 GGCCAGTTTGTAGTAACCGATGTGGAAGGTGGAAAGCTTTGGTGTTTCACAGTTGATCGA       c.1500
 G  Q  F  V  V  T  D  V  E  G  G  K  L  W  C  F  T  V  D  R         p.500

          .         .         .         .         .         .       g.17001
 GGATCAGGGGTGGTCAAATACAGCTGCCTATGTAGTGCTGTGCGGCCCAAATTTGTCACC       c.1560
 G  S  G  V  V  K  Y  S  C  L  C  S  A  V  R  P  K  F  V  T         p.520

          .         .         .         .         .         .       g.17061
 TGTGATGCTGAGGGCACCGTCTACTTCACCCAGGGCTTAGGCCTCAATCTGGAGAATCGG       c.1620
 C  D  A  E  G  T  V  Y  F  T  Q  G  L  G  L  N  L  E  N  R         p.540

          .         .         .         .         .         .       g.17121
 CAGAATGAGCACCACCTGGAGGGTGGCTTTTCCATTGGCTCTGTAGGCCCTGATGGGCAG       c.1680
 Q  N  E  H  H  L  E  G  G  F  S  I  G  S  V  G  P  D  G  Q         p.560

          .         .         .         .         .         .       g.17181
 CTGGGTCGCCAGATTAGCCACTTCTTCTCGGAGAATGAGGATTTCCGCTGCATTGCTGGC       c.1740
 L  G  R  Q  I  S  H  F  F  S  E  N  E  D  F  R  C  I  A  G         p.580

          .         .         .         .         .         .       g.17241
 ATGTGTGTGGATGCTCGTGGTGATCTCATCGTGGCTGACAGTAGTCGCAAGGAAATTCTC       c.1800
 M  C  V  D  A  R  G  D  L  I  V  A  D  S  S  R  K  E  I  L         p.600

          .         .         .         .         .         .       g.17301
 CATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTG       c.1860
 H  F  P  K  G  G  G  Y  S  V  L  I  R  E  G  L  T  C  P  V         p.620

          .         .         .         .         .         .       g.17361
 GGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATC       c.1920
 G  I  A  L  T  P  K  G  Q  L  L  V  L  D  C  W  D  H  C  I         p.640

          .         .         .         .                           g.17403
 AAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAG                         c.1962
 K  I  Y  S  Y  H  L  R  R  Y  S  T  P  X                           p.653

          .         .         .         .         .         .       g.17463
 gggatgagaaattatcagtttcttctgctcccaagccaacttcccttcccttagttcttg       c.*60

          .         .         .         .         .         .       g.17523
 gttgttagtggcacatgcagaatagactcagcctatgtcctgattccagctgggtagttc       c.*120

          .         .         .         .         .         .       g.17583
 tagaacttcagaagctccatcttttaatgtttttatttgttatgtccccctccccgcttc       c.*180

          .         .         .         .         .         .       g.17643
 ccacctaaatttagagctttaaaagatgcactgcccaaataggacacacgatggtgttag       c.*240

          .         .         .         .         .         .       g.17703
 ctgaagtttgattagcaattaggcacttccaaggctttagtagagagagccactttagcc       c.*300

          .         .         .         .         .         .       g.17763
 ctttgtgccatgtttgaaatttgcccttgtattaaatccttgattttttcccatttggct       c.*360

          .         .         .         .         .         .       g.17823
 ttgatgcccttgatccattgtttccttcctactataatgtgcttcatctgtgacactttc       c.*420

          .         .         .         .         .         .       g.17883
 tcttgaactctgattggattcactgtgcatgcttcagtgggatctgctccacctttcagt       c.*480

          .         .         .         .         .         .       g.17943
 gacatttaagacatcatattcccgtaacattatgtctcagtctgatcgtctttaccagta       c.*540

          .         .         .         .         .         .       g.18003
 tgaaagtcattcatttagtgctaccaaaggggatacacaagccctttaggaagcagtacc       c.*600

          .         .         .         .         .         .       g.18063
 tctcgcctggaggatctgtgccatcttggattgagaattgcagatgtgacagaatggatt       c.*660

          .         .         .         .         .         .       g.18123
 gaccctagttggttggtattgatgacttcagcctggaaattgcttgccttttaaagaagc       c.*720

          .         .         .         .         .         .       g.18183
 atatatgggttggaattatgccaaagcataggaagctgggaataagcaaacaaatgctga       c.*780

          .         .         .         .         .         .       g.18243
 tatagtcagcaaatttggatagtctctagggctcatcatttttcatactacctctctctt       c.*840

          .         .         .         .         .         .       g.18303
 ctggcctgtgtctaaggaattgtacaacataggccagggccaacaaagtggagaggtgga       c.*900

          .         .         .         .         .         .       g.18363
 cacattttcatgttcattactaaaacaaacagcaaaactattggtttgttattctgtgtt       c.*960

          .         .         .         .         .         .       g.18423
 ttcctcaagtcagtacatactatttggtttcaggatttctttccatttctctatcaagca       c.*1020

          .         .         .         .         .         .       g.18483
 ttaaataattgagaactgtttcttcatctctggtgttcatgtcttttaattaaatacgga       c.*1080

          .         .         .         .         .         .       g.18543
 attttggagatgataagagggataacctgcgctatgccattttgcttccttatctcactg       c.*1140

          .         .         .         .         .         .       g.18603
 tgttctttcagagtgtagatatctacccaggtcaaaattcagccaaaagcactattatgt       c.*1200

          .         .         .         .         .         .       g.18663
 aaagataataatccaaatctttctcccaaatacatgtgtacagaatcatcccccaaggtt       c.*1260

          .         .         .         .         .         .       g.18723
 tagagtcaccaataccctattctgagcttctgctgtatgttttatgtttataattacagt       c.*1320

          .         .         .         .         .         .       g.18783
 tcacaaaaaggaagttagtcttgtttttaagatcagaagtgggtgagaggacctgtgatg       c.*1380

          .         .         .         .         .         .       g.18843
 aggttcctgagggtttggtgtttactaagtaatatatcttactctaggtgcagggctgat       c.*1440

          .         .         .         .         .         .       g.18903
 ggcaagccaaagagcaactgccttactttgatgtaaacaaaatttgctaaactgagctgc       c.*1500

          .         .         .         .         .         .       g.18963
 tcaaaattgtttttatggtagtagtgtttctttggattgtatcataatagctgccaaagg       c.*1560

          .         .         .                                     g.18999
 ataggtaaagaggtcattaaaatgatgttgaactag                               c.*1596

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tripartite motif-containing 32 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center