Survival Motor Neuron 1 (SMN1) - coding DNA reference sequence

(used for mutation description)

(last modified August 28, 2009)


This file was created to facilitate the description of sequence variants in the SMN1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008691.1 and represents SMN1 mRNA transcript variant d (NM_000344.2). SMN1 mRNA variant a skips exon 8 (BC000908.2), SMN1 mRNA variant b skips exon 6 (NM_022874.1) and SMN1 mRNA variant c skips exons 6 and 8. NOTE: the SMN1 coding DNA has only 2 nucleotide differences compared to that of SMN2 (NM_022876.1); c.840C>T and c.*237G>A.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.5043
                  ccacaaatgtgggagggcgataaccactcgtagaaagcgtgag       c.-121

 .         .         .         .         .         .                g.5103
 aagttactacaagcggtcctcccggccaccgtactgttccgctcccagaagccccgggcg       c.-61

 .         .         .         .         .         .                g.5163
 gcggaagtcgtcactcttaagaagggacggggccccacgctgcgcacccgcgggtttgct       c.-1

          .         .         .         .         .         .       g.5223
 ATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTG       c.60
 M  A  M  S  S  G  G  S  G  G  G  V  P  E  Q  E  D  S  V  L         p.20

          .         .  | 02 (2a) .         .         .         .    g.18937
 TTCCGGCGCGGCACAGGCCAG | AGCGATGATTCTGACATTTGGGATGATACAGCACTGATA    c.120
 F  R  R  G  T  G  Q   | S  D  D  S  D  I  W  D  D  T  A  L  I      p.40

          .         .         .    | 03(2b).         .         .    g.21475
 AAAGCATATGATAAAGCTGTGGCTTCATTTAAG | CATGCTCTAAAGAATGGTGACATTTGT    c.180
 K  A  Y  D  K  A  V  A  S  F  K   | H  A  L  K  N  G  D  I  C      p.60

          .         .         .         .         .         .       g.21535
 GAAACTTCGGGTAAACCAAAAACCACACCTAAAAGAAAACCTGCTAAGAAGAATAAAAGC       c.240
 E  T  S  G  K  P  K  T  T  P  K  R  K  P  A  K  K  N  K  S         p.80

          .         .         .    | 04 (3).         .         .    g.22444
 CAAAAGAAGAATACTGCAGCTTCCTTACAACAG | TGGAAAGTTGGGGACAAATGTTCTGCC    c.300
 Q  K  K  N  T  A  A  S  L  Q  Q   | W  K  V  G  D  K  C  S  A      p.100

          .         .         .         .         .         .       g.22504
 ATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCAATTGATTTTAAGAGA       c.360
 I  W  S  E  D  G  C  I  Y  P  A  T  I  A  S  I  D  F  K  R         p.120

          .         .         .         .         .         .       g.22564
 GAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTGTCCGAT       c.420
 E  T  C  V  V  V  Y  T  G  Y  G  N  R  E  E  Q  N  L  S  D         p.140

          .         .         .         .         .     | 05(4).    g.22783
 CTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAG | AATGAA    c.480
 L  L  S  P  I  C  E  V  A  N  N  I  E  Q  N  A  Q  E   | N  E      p.160

          .         .         .         .         .         .       g.22843
 AATGAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCA       c.540
 N  E  S  Q  V  S  T  D  E  S  E  N  S  R  S  P  G  N  K  S         p.180

          .         .         .         .         .         .       g.22903
 GATAACATCAAGCCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATG       c.600
 D  N  I  K  P  K  S  A  P  W  N  S  F  L  P  P  P  P  P  M         p.200

          .         .        | 06. (5)     .         .         .    g.24750
 CCAGGGCCAAGACTGGGACCAGGAAAG | CCAGGTCTAAAATTCAATGGCCCACCACCGCCA    c.660
 P  G  P  R  L  G  P  G  K   | P  G  L  K  F  N  G  P  P  P  P      p.220

          .         .         .         .         .         .       g.24810
 CCGCCACCACCACCACCCCACTTACTATCATGCTGGCTGCCTCCATTTCCTTCTGGACCA       c.720
 P  P  P  P  P  P  H  L  L  S  C  W  L  P  P  F  P  S  G  P         p.240

     | 07 (6).         .         .         .         .         .    g.26182
 CCA | ATAATTCCCCCACCACCTCCCATATGTCCAGATTCTCTTGATGATGCTGATGCTTTG    c.780
 P   | I  I  P  P  P  P  P  I  C  P  D  S  L  D  D  A  D  A  L      p.260

          .         .         .         .         .     | 08(7).    g.32006
 GGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTATTATATG | GGTTTC    c.840
 G  S  M  L  I  S  W  Y  M  S  G  Y  H  T  G  Y  Y  M   | G  F      p.280

          .         .         .         .                       g.32051
 AGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAA |                   c.886
 R  Q  N  Q  K  E  G  R  C  S  H  S  L  N  X                     p.294

     | 09 (8).         .         .         .         .         .    g.32555
 gga | gaaatgctggcatagagcagcactaaatgacaccactaaagaaacgatcagacagat    c.*60

          .         .         .         .         .         .       g.32615
 ctggaatgtgaagcgttatagaagataactggcctcatttcttcaaaatatcaagtgttg       c.*120

          .         .         .         .         .         .       g.32675
 ggaaagaaaaaaggaagtggaatgggtaactcttcttgattaaaagttatgtaataacca       c.*180

          .         .         .         .         .         .       g.32735
 aatgcaatgtgaaatattttactggactctattttgaaaaaccatctgtaaaagactggg       c.*240

          .         .         .         .         .         .       g.32795
 gtgggggtgggaggccagcacggtggtgaggcagttgagaaaatttgaatgtggattaga       c.*300

          .         .         .         .         .         .       g.32855
 ttttgaatgatattggataattattggtaattttatgagctgtgagaagggtgttgtagt       c.*360

          .         .         .         .         .         .       g.32915
 ttataaaagactgtcttaatttgcatacttaagcatttaggaatgaagtgttagagtgtc       c.*420

          .         .         .         .         .         .       g.32975
 ttaaaatgtttcaaatggtttaacaaaatgtatgtgaggcgtatgtggcaaaatgttaca       c.*480

          .         .         .         .         .         .       g.33035
 gaatctaactggtggacatggctgttcattgtactgtttttttctatcttctatatgttt       c.*540

          .         .         .                                     g.33072
 aaaagtatataataaaaatatttaatttttttttaaa                              c.*577

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Survival Motor Neuron 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center