Sarcoglycan zeta (SGCZ) - coding DNA reference sequence

(used for mutation description)

(last modified March 28, 2009)


This file was created to facilitate the description of sequence variants in the SGCZ gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008899.1, covering SGCZ transcript NM_139167.2.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
 .         .         .         .         .         .                g.60
 cttttagcataaccttcaaaggagaacgttcccttctgacttgattatcttcttttcccc       c.-601

 .         .         .         .         .         .                g.120
 actgagaaaatacctctcagctacaagacattttttaagtctatgcaggacttcggggat       c.-541

 .         .         .         .         .         .                g.180
 tctgttatcttgccggggaaactgatcattgctaatgcctgggactggagctaaattacc       c.-481

 .         .         .         .         .         .                g.240
 taccagagtaagcctgacggaggaagccttttatcatacactcttctcttcagtttgaac       c.-421

 .         .         .         .         .         .                g.300
 acatttgcttgaaatttgccgcatgatgctgaccagggaagcagctttttttctcgggat       c.-361

 .         .         .         .         .         .                g.360
 gcagcaattcgctgggttctaagcttattgcagaagaagaaataatcttaaatagagtgg       c.-301

 .         .         .         .         .         .                g.420
 atttttttttccttttttcttttggcccctgtttcaatcgactcagctgtgttgcaccgc       c.-241

 .         .         .         .         .         .                g.480
 ggtagagatcacctgtcactaaatctttgaggaagtaaaataaagtgaattatcattatt       c.-181

 .         .         .         .         .         .                g.540
 atttatttattttccttatttttaacccggtggaggcggcgtgaccacggagaatgagac       c.-121

 .         .         .         .         .         .                g.600
 tgagaggagctgccggggcttggaggaggataaagctgagtttaagctggaaactaaaag       c.-61

 .         .         .         .         .         .                g.660
 actagattgtttttgggtgccactcgcccggttcctctccacttcgtttagttgcgctcc       c.-1

          .         .         .          | 02        .         .    g.683378
 ATGGACAGATCAACGAACCTGGACATTGAGGAGCTCAAG | ATGACACGAGAACAATACATA    c.60
 M  D  R  S  T  N  L  D  I  E  E  L  K   | M  T  R  E  Q  Y  I      p.20

          .         .         .         .         .         .       g.683438
 CTAGCAACCCAACAGAATAACCTGCCAAGGACTGAGAATGCACAACTTTACCCAGTGGGA       c.120
 L  A  T  Q  Q  N  N  L  P  R  T  E  N  A  Q  L  Y  P  V  G         p.40

          .         .         .         .         .         .       g.683498
 ATTTATGGATGGCGAAAGAGGTGCTTATACTTCTTTGTCCTTCTGCTGTTGGTTACCATG       c.180
 I  Y  G  W  R  K  R  C  L  Y  F  F  V  L  L  L  L  V  T  M         p.60

          .         .         .         .         .     | 03   .    g.914085
 ATAGTTAACTTAGCCATGACAATATGGATATTGAAAGTTATGAATTTCACTGTG | GATGGT    c.240
 I  V  N  L  A  M  T  I  W  I  L  K  V  M  N  F  T  V   | D  G      p.80

          .         .         .         .         .         .       g.914145
 ATGGGAAATCTGAGAGTCACCAAGAAGGGAATCCGACTTGAAGGTATATCTGAGTTTCTA       c.300
 M  G  N  L  R  V  T  K  K  G  I  R  L  E  G  I  S  E  F  L         p.100

          .         .         .       | 04 .         .         .    g.1000628
 CTTCCATTGTATGTGAAAGAAATTCATTCTCGAAAG | GATAGTCCGCTGGTCTTACAGTCT    c.360
 L  P  L  Y  V  K  E  I  H  S  R  K   | D  S  P  L  V  L  Q  S      p.120

          .         .         .         .         .         .       g.1000688
 GACAGGAATGTCACAGTGAATGCAAGAAATCACATGGGGCAGTTAACCGGACAGCTGACC       c.420
 D  R  N  V  T  V  N  A  R  N  H  M  G  Q  L  T  G  Q  L  T         p.140

      | 05   .         .         .         .         .         .    g.1073637
 ATAG | GAGCTGATGCTGTGGAAGCTCAGTGTAAAAGATTTGAAGTGAGAGCCAGTGAAGAT    c.480
 I  G |   A  D  A  V  E  A  Q  C  K  R  F  E  V  R  A  S  E  D      p.160

          .         .         .         .         .         .       g.1073697
 GGCAGGGTGCTGTTTTCTGCAGATGAAGATGAGATTACCATTGGGGCTGAAAAGCTGAAA       c.540
 G  R  V  L  F  S  A  D  E  D  E  I  T  I  G  A  E  K  L  K         p.180

         | 06.         .         .         .         .         .    g.1130101
 GTTACAG | GCACTGAAGGAGCCGTATTTGGGCACTCTGTGGAGACGCCGCACATCAGAGCA    c.600
 V  T  G |   T  E  G  A  V  F  G  H  S  V  E  T  P  H  I  R  A      p.200

          .         . | 07       .         .         .         .    g.1135824
 GAGCCATCCCAAGATCTCAG | GCTTGAATCACCCACCAGATCCTTGATCATGGAAGCTCCC    c.660
 E  P  S  Q  D  L  R  |  L  E  S  P  T  R  S  L  I  M  E  A  P      p.220

          .         .         .         .         .         .       g.1135884
 CGTGGGGTCCAGGTGAGTGCTGCTGCAGGAGACTTCAAGGCCACCTGCAGGAAGGAGCTC       c.720
 R  G  V  Q  V  S  A  A  A  G  D  F  K  A  T  C  R  K  E  L         p.240

          .         .     | 08   .         .         .         .    g.1147682
 CATCTGCAATCTACAGAAGGGGAG | ATATTTTTAAATGCAGAGACAATCAAGCTGGGAAAT    c.780
 H  L  Q  S  T  E  G  E   | I  F  L  N  A  E  T  I  K  L  G  N      p.260

          .         .         .         .         .         .       g.1147742
 CTACCAACTGGCTCCTTCTCATCTTCTTCACCCAGCTCCTCAAGTTCTCGACAGACAGTG       c.840
 L  P  T  G  S  F  S  S  S  S  P  S  S  S  S  S  R  Q  T  V         p.280

          .         .         .         .         .         .       g.1147802
 TATGAACTCTGCGTCTGCCCCAATGGCAAACTTTACCTTTCTCCAGCAGGAGTAGGTTCC       c.900
 Y  E  L  C  V  C  P  N  G  K  L  Y  L  S  P  A  G  V  G  S         p.300

          .         .         .                                     g.1147841
 ACTTGTCAGTCCAGTAGCAACATCTGCCTGTGGAGCTGA                            c.939
 T  C  Q  S  S  S  N  I  C  L  W  S  X                              p.312

          .         .         .         .         .         .       g.1147901
 agtgactgatttctcctcacaccagaatagccttttgttcctgtccgtctgcttcacagt       c.*60

          .         .         .         .         .         .       g.1147961
 tctgctcggtttcccttgtgatcagtccagagcttcttcgaatggtccacagagcaactt       c.*120

          .         .         .         .         .         .       g.1148021
 ccagtgtgagcagggattcgccaccaccttctcttgtgatttactgtactgctcaacaca       c.*180

          .         .         .         .         .         .       g.1148081
 gagggtgtgattgacacagcagtggaaaaagcgtcgtcagcaggaaaactggatcatgac       c.*240

          .         .         .         .         .         .       g.1148141
 ttttgctcgaaagggagaataacataggtgcctttgctacgcgaagtgaagcacacagtt       c.*300

          .         .         .         .         .         .       g.1148201
 ttagatttttgcaggacctggatatgaactgcacatatatacattacataaatgaaattc       c.*360

          .         .         .         .         .         .       g.1148261
 ccagtatccaatggcaagatgaaatggttaaccctgtaagaaaacttattctacattctg       c.*420

          .         .         .         .         .         .       g.1148321
 aaagcacaattttccattcatctttttggatgtaaacttttatccccgacttttaaaatt       c.*480

          .         .         .         .         .         .       g.1148381
 ttaaagcattatgtaatgcttgctttactaaaatttaaattcaatacatggtttttaaca       c.*540

          .         .         .                                     g.1148420
 aaacagaacaaaacaaaacaatacagaatctctccctga                            c.*579

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan zeta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center