Sarcoglycan delta (SGCD) - coding DNA reference sequence

(used for mutation description)

(last modified December 18, 2009)


This file was created to facilitate the description of sequence variants in the SGCD gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008693.1, covering SGCD transcript 1 (NM_000337.5). Transcript variant 2 (NM_172244.2) contains an alternative 3'-terminal exon 8b, ending in intron 8. GenBank contains another alternative transcript, variant 3 (NM_001128209.1), missing exon 2, encoding a 1 amino acid shorter protein.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                               .         .         .                g.5039
                      agagaggacttatctccagcatctagcactacagagcag       c.-481

 .         .         .         .         .         .                g.5099
 aggctgtgtggagaatggctgaaaaatcagaattggttgtagaagcagttttctttctgg       c.-421

 .         .         .         .         .         .                g.5159
 ttgtgagtatgagcccggcagacaccatgagcgctgttgcaggggagtcggcctgtgctt       c.-361

 .         .         .         .         .         .                g.5219
 gacacatgtgtttcccattgatagctggagacagcccagtagctgtgagtcggtctgaca       c.-301

 .         .         .         .         .         .                g.5279
 aagccatattgaagtacggagtacggtttcaaagcagtcagaaaaagaacgggaatgctg       c.-241

 .         .         .         .         .         .                g.5339
 ttcaggaaattcttcaggcatgggcagggacttggctgcagttctgcagttggaaaatct       c.-181

 .         .         .         .         .         .                g.5399
 gactggggcagcttctgagcgcaggctgggcctgcacacactcagcgggccgagtggcca       c.-121

 .         .         .         .         .         .                g.5459
 cctccttcagagctgctcagcacgccctgggatcgcgggcggttttcatcggccggtttg       c.-61

 .         .       | 02 .         .         .         .             g.7820
 tgaaacggacaagagag | agacattactgccgggagtgttgagtgaagggaccaggtggag    c.-1
                   ^ alternatively exon, missing in some transcripts

     | 03    .         .         .         .         .         .    g.22789
 ATG | ATGCCTCAGGAGCAGTACACTCACCACCGGAGCACCATGCCTGGCTCTGTGGGGCCA    c.60
 M   | M  P  Q  E  Q  Y  T  H  H  R  S  T  M  P  G  S  V  G  P      p.20

          .         .         .         .         .         .       g.22849
 CAGGTATACAAGGTGGGGATTTATGGCTGGCGGAAACGATGCCTGTATTTCTTTGTCCTG       c.120
 Q  V  Y  K  V  G  I  Y  G  W  R  K  R  C  L  Y  F  F  V  L         p.40

          .         .         .         .         .         .       g.22909
 CTCCTCATGATTTTAATACTGGTGAACTTGGCCATGACCATCTGGATTCTCAAAGTCATG       c.180
 L  L  M  I  L  I  L  V  N  L  A  M  T  I  W  I  L  K  V  M         p.60

          .   | 04     .         .         .         .         .    g.186892
 AACTTCACAATT | GATGGAATGGGAAACCTGAGGATCACAGAAAAAGGTCTAAAGCTAGAA    c.240
 N  F  T  I   | D  G  M  G  N  L  R  I  T  E  K  G  L  K  L  E      p.80

          .         .         .         .         .     | 05   .    g.267480
 GGAGACTCTGAATTCTTACAACCTCTCTACGCCAAAGAAATCCAGTCCCGACCA | GGTAAT    c.300
 G  D  S  E  F  L  Q  P  L  Y  A  K  E  I  Q  S  R  P   | G  N      p.100

          .         .         .         .         .         .       g.267540
 GCCCTGTACTTCAAGTCTGCCAGAAATGTTACAGTGAACATTCTCAATGACCAGACTAAA       c.360
 A  L  Y  F  K  S  A  R  N  V  T  V  N  I  L  N  D  Q  T  K         p.120

          .         .   | 06     .         .         .         .    g.273213
 GTGCTAACTCAGCTTATAACAG | GTCCAAAAGCCGTAGAAGCTTATGGTAAAAAATTTGAG    c.420
 V  L  T  Q  L  I  T  G |   P  K  A  V  E  A  Y  G  K  K  F  E      p.140

          .         .         .         .         .         .       g.273273
 GTAAAAACTGTTTCTGGAAAATTGCTCTTCTCTGCAGACAATAATGAAGTGGTAGTAGGA       c.480
 V  K  T  V  S  G  K  L  L  F  S  A  D  N  N  E  V  V  V  G         p.160

          .         .   | 07     .         .         .         .    g.325745
 GCTGAAAGATTACGAGTTTTAG | GAGCGGAGGGCACAGTGTTCCCTAAATCTATAGAAACA    c.540
 A  E  R  L  R  V  L  G |   A  E  G  T  V  F  P  K  S  I  E  T      p.180

          .         .         .      | 08  .         .         .    g.435850
 CCTAATGTCAGGGCAGACCCCTTCAAAGAACTAAG | GTTGGAGTCCCCAACCCGGTCTCTA    c.600
 P  N  V  R  A  D  P  F  K  E  L  R  |  L  E  S  P  T  R  S  L      p.200

          .         .         .         .         .         .       g.435910
 GTGATGGAGGCCCCAAAAGGAGTGGAAATCAATGCAGAAGCTGGCAATATGGAAGCCACC       c.660
 V  M  E  A  P  K  G  V  E  I  N  A  E  A  G  N  M  E  A  T         p.220

          .         .         .          | 09        .         .    g.437482
 TGCAGGACAGAGCTGAGACTGGAATCCAAAGATGGAGAG | ATTAAGTTAGATGCTGCGAAA    c.720
 C  R  T  E  L  R  L  E  S  K  D  G  E   | I  K  L  D  A  A  K      p.240

          .         .         .         .         .         .       g.437542
 ATCAGGCTACCTAGACTGCCTCATGGATCCTACACGCCTACAGGAACGAGGCAGAAGGTC       c.780
 I  R  L  P  R  L  P  H  G  S  Y  T  P  T  G  T  R  Q  K  V         p.260

          .         .         .         .         .         .       g.437602
 TTCGAGATCTGCGTCTGCGCCAATGGGAGATTATTCCTGTCTCAGGCAGGAGCTGGGTCC       c.840
 F  E  I  C  V  C  A  N  G  R  L  F  L  S  Q  A  G  A  G  S         p.280

          .         .         .                                     g.437635
 ACTTGTCAGATAAACACAAGTGTCTGCCTCTGA                                  c.873
 T  C  Q  I  N  T  S  V  C  L  X                                    p.290

          .         .         .         .         .         .       g.437695
 aagactatccatagtggacattgttggcagcataaaggccttttttggctttagacactg       c.*60

          .         .         .         .         .         .       g.437755
 gctgccagctatttttactagaacacagaaagcctatcaaagaccttgtgtgtatgtgta       c.*120

          .         .         .         .         .         .       g.437815
 cgtgtgtgtgcgtgcttgagtgtgttcgcgtgtgtgggtggatataaatatatataaata       c.*180

          .         .         .         .         .         .       g.437875
 tatataaataaatatatatatcctctgtataaaatgaggtttcagtacaaaaggaaccat       c.*240

          .         .         .         .         .         .       g.437935
 gggtgaccctgcgatatccactgtcattttccatcccatccccaccacctgagtgacaga       c.*300

          .         .         .         .         .         .       g.437995
 aatctaaacacacatccgtcccaacattccccagaccattcagaatcacacagcgtatta       c.*360

          .         .         .         .         .         .       g.438055
 aacactgacagaatcttcatctagatattcgagtagcagcatatcttctcttttagtgtc       c.*420

          .         .         .         .         .         .       g.438115
 attacgagggagtgatggcgggaatctcagtcgcactcaagctctgagacctttgtatca       c.*480

          .         .         .         .         .         .       g.438175
 aaaataggcatttgatttcctgttttagctttagtaaggctggctaacttccccctcttc       c.*540

          .         .         .         .         .         .       g.438235
 aagctaggaactggcaatgctgtagaagtcagccgtaggaattcaaaatggctggcctac       c.*600

          .         .         .         .         .         .       g.438295
 cttggctaccagacatattggggtttttgtagttgaatgaatgaggaggatgaatttcag       c.*660

          .         .         .         .         .         .       g.438355
 caaattttgaactgctcacccaacttctgctatcttgctccctccaaactcacagattct       c.*720

          .         .         .         .         .         .       g.438415
 cctacagtcaaattaggagctgtaaatcagcacaaaataagataacagctgttcctcagt       c.*780

          .         .         .         .         .         .       g.438475
 gagctggaagctacttaatggcctgatgggcaatgaacaaacgggtgatatgtctctgtt       c.*840

          .         .         .         .         .         .       g.438535
 taagggaaaaatggcttaaaagctgttctgttctcacttctgactttaaccaaaagattt       c.*900

          .         .         .         .         .         .       g.438595
 caacccacaatgatcaggtcaatcaaaatccctaagagcagaactcctaccccaaaagaa       c.*960

          .         .         .         .         .         .       g.438655
 gcctggaagtctaattaagagtagcataaggaacctaattatgtttaccatgtttcttgg       c.*1020

          .         .         .         .         .         .       g.438715
 gattggtgggaaatgtcaaaacatgccctttatttttaaaggcattcacaaactctctga       c.*1080

          .         .         .         .         .         .       g.438775
 ctttgttcttcttatatattttttcagtgccgggatattcatattcctaaagccactatt       c.*1140

          .         .         .         .         .         .       g.438835
 gtgttttctctaagaagcactacatgccaccagaattgtgcactgaaagataatacaaac       c.*1200

          .         .         .         .         .         .       g.438895
 tgagtgtctttatgagaatcactgtgtcccctgaggcccagcagtacctgcttccctgta       c.*1260

          .         .         .         .         .         .       g.438955
 tgtggaagcagcacctcattcccgccatcagctacctctcatcaccccaccttcatcatc       c.*1320

          .         .         .         .         .         .       g.439015
 atgctccagggtcaccctggccagctcttgtgctgggacaggggattacaccatctctgt       c.*1380

          .         .         .         .         .         .       g.439075
 tcaaagagggggaaatgtgcctatgccttaagtcaatgcactcagcaaggagaagcacat       c.*1440

          .         .         .         .         .         .       g.439135
 cttatttatcttgttacctatagtttactttgggtgattggaggggaatgacttagttat       c.*1500

          .         .         .         .         .         .       g.439195
 gactggacatcttaaaagctgatagacaagccaaatggctggcagatgatgtggatttca       c.*1560

          .         .         .         .         .         .       g.439255
 aagagcccagaatgaactcatcactggcttagacagtcctggatgccatttggaaagtag       c.*1620

          .         .         .         .         .         .       g.439315
 tggccctgcaagcctaaatgaagtagtatttgtaggcctgggtggcatttggatttttct       c.*1680

          .         .         .         .         .         .       g.439375
 tttccctcaacaaggttttactttttcttactttacaagcaagggaagttttgtgatagg       c.*1740

          .         .         .         .         .         .       g.439435
 agagaaataaaagatttgatattttttgagatgacactcaagcatcaggctgagatttgc       c.*1800

          .         .         .         .         .         .       g.439495
 acacatgggatgtaaaagcaagctgtgtgttgcttagtcacttacttagaagtagatggt       c.*1860

          .         .         .         .         .         .       g.439555
 gggggacagcggcgtgggtcctagcctggccagtgatgctgctggcgtccagaccccaga       c.*1920

          .         .         .         .         .         .       g.439615
 ctcactccaagcactcttgttcaatatctcatgcagaagagttgggctggtcactcttag       c.*1980

          .         .         .         .         .         .       g.439675
 gggtgagaccccgtgattggttggtttgtagcactaaggtctaaaaaggaaaaccataaa       c.*2040

          .         .         .         .         .         .       g.439735
 agacatcagattacgctggatcagtataattaatattccatagggccatgttgccagaat       c.*2100

          .         .         .         .         .         .       g.439795
 ctgtatgtatcaatacagggtttttccaagccaggaaacgccctccttggctactaggag       c.*2160

          .         .         .         .         .         .       g.439855
 cacctatcccatatcattcagataaacaatgatagctacaaagtcatttgtggctagata       c.*2220

          .         .         .         .         .         .       g.439915
 ggttaagacaggtgattttttaaagtagactgtctttgcattttgccatctgaagttcat       c.*2280

          .         .         .         .         .         .       g.439975
 taatctttagatgacaaaaaagcaaaaagttcccagaacgtttttgcttagattttgttc       c.*2340

          .         .         .         .         .         .       g.440035
 taatcaccacgtgaaggaatgagattagcaccacaagtttcatgccaataaaagagactg       c.*2400

          .         .         .         .         .         .       g.440095
 gtgtgatcccacatgcaaaatttaatcctaagggtagtgagatcacaaacagaataaaaa       c.*2460

          .         .         .         .         .         .       g.440155
 taagagcaatcaaccatataaatcaagtacctattgggaacagacataacattcaatttt       c.*2520

          .         .         .         .         .         .       g.440215
 tcatttatgctaagtgaccacagtatacaaagtaataagcaggaaatttgatatgggtta       c.*2580

          .         .         .         .         .         .       g.440275
 aattatgcattttgttcagattttggaaattggtatgcattataagtttctcaatgtaca       c.*2640

          .         .         .         .         .         .       g.440335
 tctttttatcccaacaccctcaaactagaatatttgtcagtggtcaagagaaaaaatttt       c.*2700

          .         .         .         .         .         .       g.440395
 acctgaattcttgggggccggcggggagcttttacattaaaaatctactaacgcctactt       c.*2760

          .         .         .         .         .         .       g.440455
 tttaaaaaatgagattctttctaatctttatatatgacattttctagacaatcgcacctt       c.*2820

          .         .         .         .         .         .       g.440515
 tgggtatattaaacagctggtatcataacaaagaatccaaatgaaccttcaatatactag       c.*2880

          .         .         .         .         .         .       g.440575
 aagttctagtaggttaatattgttcagaagatttttacaaattaaaaactgatttccaaa       c.*2940

          .         .         .         .         .         .       g.440635
 tatgttcaacatttacttctatttgatatctgctcaagaagtcatagaagtcttgggaaa       c.*3000

          .         .         .         .         .         .       g.440695
 ctattcgagtatcacagaggttttcaaaagcccttatggtgacatctacctaggtaaaag       c.*3060

          .         .         .         .         .         .       g.440755
 cctgacatgtggctttataattgttatgttacccaagggataaacttgaactggctttga       c.*3120

          .         .         .         .         .         .       g.440815
 acatcctttaggtcattttctctttggataattttcatcgcatatccagcaactatagac       c.*3180

          .         .         .         .         .         .       g.440875
 caaagtttgcttaaggtttgaccctagagcagaggtgggcaaactatgacctggaaacca       c.*3240

          .         .         .         .         .         .       g.440935
 aatctgacttaccaccttttcctgtagttaaagttttattgtcacatagccacatacatt       c.*3300

          .         .         .         .         .         .       g.440995
 catttacatgttttctgattttacactacagcagcaggatggagtagttgtgtcagagac       c.*3360

          .         .         .         .         .         .       g.441055
 tatgtatcccacaaagcatagattacttactatttagtcctttacaggcaaagtttcctc       c.*3420

          .         .         .         .         .         .       g.441115
 acccctgacctagaggtttttgtggtatgcattggatatagcaggaaagaaagcacattt       c.*3480

          .         .         .         .         .         .       g.441175
 ccaaacagcagggagtaagcttacatttctgtgtaggtttgggaatatagttacttggca       c.*3540

          .         .         .         .         .         .       g.441235
 aagtctttcaggaaggaagcccttccttatgttacatgtggaaagcctgccttccaagac       c.*3600

          .         .         .         .         .         .       g.441295
 atgtggaagtaattgatccacctgccagagaaacacaggctcagaggatgcctgggaaca       c.*3660

          .         .         .         .         .         .       g.441355
 gggaggatgggattagtggaagcttaatggaaaaggaaagttatgatcctccaagaccct       c.*3720

          .         .         .         .         .         .       g.441415
 taattgatagaccataccaggttctgcaggtcagcatcattgtgtaatgagagtgaagta       c.*3780

          .         .         .         .         .         .       g.441475
 ggggaccctgtggttcaaccttagaatctgtttcctgtaggctctttctgctgtctatat       c.*3840

          .         .         .         .         .         .       g.441535
 tcattaaagttttccacttcaccctcccatagtctagagggatgcccattccatggtcct       c.*3900

          .         .         .         .         .         .       g.441595
 ccagagaatagttttgacttaacatgtctgtttagcccacatcacgtcagttatcaacac       c.*3960

          .         .         .         .         .         .       g.441655
 cgccactgtgcttactgttcctacagccacaccaggcttgaagagttagtgagaccaaca       c.*4020

          .         .         .         .         .         .       g.441715
 aataattggaagtattggaaaaagcaaaatacatggggacaaaaaaaatacagtgaaatt       c.*4080

          .         .         .         .         .         .       g.441775
 ctttttatcaaactgatgctgtgagaaaccagatgaatgccagtttggctttatttctaa       c.*4140

          .         .         .         .         .         .       g.441835
 gaatctgggtcttcattctctggtgtagaaggaatgcaaaaaactataacaacaacaaca       c.*4200

          .         .         .         .         .         .       g.441895
 aaaacatattttgaaaagacatattctgacatctctgcttgtgtgtggtaaggcaggttc       c.*4260

          .         .         .         .         .         .       g.441955
 ctatcagacatttatccctttggtcaagatcccttttgctcatccagggtttcatactca       c.*4320

          .         .         .         .         .         .       g.442015
 atatcgcttaaaaaaaaaaaagtatcagctagggatgactctggaagtatgagtatcatg       c.*4380

          .         .         .         .         .         .       g.442075
 gtggggaggaaggaattttttttaaatgtaaatgacccccatttaccagaccctaatcaa       c.*4440

          .         .         .         .         .         .       g.442135
 agtcacttaagggaatccctcagccttttatttggaaacagttgaaataaactggcagca       c.*4500

          .         .         .         .         .         .       g.442195
 gctagatcagagtatcttgctttattttataaaggccaaaggtagtatgaagtttggacc       c.*4560

          .         .         .         .         .         .       g.442255
 aaaaaggtaaatagatccattccagcacctgatactgatttttcaaggctctatgaaagg       c.*4620

          .         .         .         .         .         .       g.442315
 tcaaaaatttcattaaacaagaccagttctccctcttccccctgtcccaagaaatcttag       c.*4680

          .         .         .         .         .         .       g.442375
 gcatgaaaaggataaggaaacagctcctggaatgatacatttgcatagtgccctagtagc       c.*4740

          .         .         .         .         .         .       g.442435
 aggttgggaaaaagttataatataagaaacaaccttcgaaaacaggccttttatctcaaa       c.*4800

          .         .         .         .         .         .       g.442495
 gataaaatgtctttcttgtggtctttcatcactatctccgtggtggaaggttcccctagt       c.*4860

          .         .         .         .         .         .       g.442555
 tccaacatatttccattaaaatagtcaaagccacggcattgggatgtcagatgcctctct       c.*4920

          .         .         .         .         .         .       g.442615
 ttctttgtggtaatcggaatttaaaattatacagttgcctctgaatttctcatgcacaaa       c.*4980

          .         .         .         .         .         .       g.442675
 gccaaaccactgataagagataaagcagtctgaagcctgctgcttcagccagcacagcac       c.*5040

          .         .         .         .         .         .       g.442735
 accacacacgctcgcactttcaaaagcaatgtgatttctatggttcttaaaagctttctt       c.*5100

          .         .         .         .         .         .       g.442795
 cataagggagtccctgaaatttctcaaggcaggtttgaatggcaaagggaaaataattac       c.*5160

          .         .         .         .         .         .       g.442855
 ttgtgggaggtcctccttttgagtattgttagagcatacatgtaaaagaaaataaccttt       c.*5220

          .         .         .         .         .         .       g.442915
 ttggggcaactcatgctcacacatgctgttttctttggttctccccctaccttccttttg       c.*5280

          .         .         .         .         .         .       g.442975
 tagatattgacagaataggaggaaatgagcatccttatttgagaaagagcaagaatgtca       c.*5340

          .         .         .         .         .         .       g.443035
 tgagcccttgatgcaatagtaagtgtgatgtcatcatacagtgttaatgatgctatcaaa       c.*5400

          .         .         .         .         .         .       g.443095
 tccatcaataaacagtctcaaaccttccaacaacagtgctcactgctgctcctcaacttc       c.*5460

          .         .         .         .         .         .       g.443155
 agcccagcaagcagtaatatcatcacccattttgagatatgcaggtggaatagaacaaag       c.*5520

          .         .         .         .         .         .       g.443215
 aaacagccactgtaatcgagaagcatgtttactgtctaaatccacctgttgcagtaggaa       c.*5580

          .         .         .         .         .         .       g.443275
 gccagagtggggttccaaatgcctcattaagtatgtggacagcctcactagtaagtgagt       c.*5640

          .         .         .         .         .         .       g.443335
 gaatttggcttcatcactgaacattagctaaggtcagcttaataacacaaatatgaggcc       c.*5700

          .         .         .         .         .         .       g.443395
 gacttctttgcgagaagagaaaagaaaacatctgcttgatttaaaatccaccccacatgc       c.*5760

          .         .         .         .         .         .       g.443455
 ctagagttgtctaatagtccctcactttccaatggcttcacatcctacttctacatttgg       c.*5820

          .         .         .         .         .         .       g.443515
 ggttttttggtgaaatcagagatagctcaggatttcataaaacgagaaactccaaactgg       c.*5880

          .         .         .         .         .         .       g.443575
 tctattaggttccatgggaacacttgtagccaaaggattgtctgagggcaggaagacgac       c.*5940

          .         .         .         .         .         .       g.443635
 acttgtcaacaaggaagacagtgtttctttagttcccatattcatctaattcatggggtt       c.*6000

          .         .         .         .         .         .       g.443695
 ctaacattttggggggccatagattcttttgacaatctgagccaatctatgaaacttctc       c.*6060

          .         .         .         .         .         .       g.443755
 cccaaaaagaaccaccccacaaaatcttgcaaaacgtaagagattttcctggatctgaag       c.*6120

          .         .         .         .         .         .       g.443815
 ctacccgaagacatgggaagagttgtattctattattcaattttaagaatatttattaat       c.*6180

          .         .         .         .         .         .       g.443875
 attcactgagctattgctagccactgtgctaaacattttacatacattctcctatttcat       c.*6240

          .         .         .         .         .         .       g.443935
 cctcaaaacaatcctttgagttgggttttaatatagttccaatattcggatgtgaaaact       c.*6300

          .         .         .         .         .         .       g.443995
 gaggcttatagtggctaagaaacttgcccaaagccactacctagaaaatggcagagctgg       c.*6360

          .         .         .         .         .         .       g.444055
 aatgtaggtttaactcctgaccactatgctataaagtcaccacatgtcaaactaattttc       c.*6420

          .         .         .         .         .         .       g.444115
 aagttgttgggacatgtcccctactaggttttaaactagatcttccttggtagatgaagc       c.*6480

          .         .         .         .         .         .       g.444175
 tatagaacttctattttccctgctttctgtagtctctcacagtgacagcatctatactaa       c.*6540

          .         .         .         .         .         .       g.444235
 agtatagatacctaaggggaaaatatagaaagcctgcctgaataatagaatctagaacaa       c.*6600

          .         .         .         .         .         .       g.444295
 caacaaaaatattaattttttctgtgtatgcttaggtcaagcttaaaaaaaaaaaaaaaa       c.*6660
                                                            ^ polyA addition site

          .         .         .         .         .         .       g.444355
 gaccggaaaatacctgggttgttagcctcacatttaggaaaaaattgtaatactcagtta       c.*6720

          .         .         .         .         .         .       g.444415
 tctgtgtgtgtggctaaacaagtcagcatttctgcacacatacatctctttcctttatac       c.*6780

          .         .         .         .         .         .       g.444475
 ttcccttcaaaagacaaatatcttacttttgatctttgacactatttggtcagtattctt       c.*6840

          .         .         .         .         .         .       g.444535
 ctttacctttacttgtggcaaaactcaaggaagcgatcaaatagagggaagctcatttct       c.*6900

          .         .         .         .         .         .       g.444595
 atcattgtctctgtttccctataagaaagaactaccagggactcactgactgcattaggc       c.*6960

          .         .         .         .         .         .       g.444655
 atacaatgtcagagctgagctgaccactctggtcctgtaatgtctttggcctcacacctt       c.*7020

          .         .         .         .         .         .       g.444715
 ggcagccatcattaatgggccatacccttccccaggtgcagaattctcctccccagagca       c.*7080

          .         .         .         .         .         .       g.444775
 ctcaggccgttactaccaatttatctgagttggaaataagactcatttgccagttcttat       c.*7140

          .         .         .         .         .         .       g.444835
 ttttaaagtggcaccctttaactttgaacctgtgtattttacactggcatcctagattca       c.*7200

          .         .         .         .         .         .       g.444895
 gcaatgaggtttggtggtgtttcaactaggaagggagaaaatgagtgcatctgaagttcc       c.*7260

          .         .         .         .         .         .       g.444955
 ttacagcttggtttctttggaatgctttcatcttctaagcaaagggatcagggtttgatc       c.*7320

          .         .         .         .         .         .       g.445015
 tgtaagagttaaaaagacaaagtcattttgaagaattaactcagccagggatcatgcaaa       c.*7380

          .         .         .         .         .         .       g.445075
 aagattagaaaccataatgcccttgttaaagccctgctgtcaacctgccttcacccagag       c.*7440

          .         .         .         .         .         .       g.445135
 cttagagggccacagcagcaaagaggttggggtccatccctctctgatgtgctttttcca       c.*7500

          .         .         .         .         .         .       g.445195
 caacacatatctggtcctctggcaggattgtggatagagctcctcaccatacccaaaaga       c.*7560

          .         .         .         .         .         .       g.445255
 ctcagccccagtgccagtgctttcctggttcaacaacccaccacaaaaccttagtaaaag       c.*7620

          .         .         .         .         .         .       g.445315
 gatgagccaaaaatgaaaaagactcgactctacagtaagtcagtcagggatttccttttt       c.*7680

          .         .         .         .         .         .       g.445375
 aatggtttaagacatccaaatggcaagccaggaatagataccattaaagggtctcatagg       c.*7740

          .         .         .         .         .         .       g.445435
 actaaccttaccagagccagaaatctagctctctggaagagatgcaagattctagaaaag       c.*7800

          .         .         .         .         .         .       g.445495
 taaagggaagtgtcggcacatctaaatttagtgaacacaaaattaatttttatctagtct       c.*7860

          .         .         .         .         .         .       g.445555
 gtgacggagggaataaagtttttcatgtatcaaccacctcccccagtcaggtttctccct       c.*7920

          .         .         .         .         .         .       g.445615
 ttttgagattatgaagaagctgagacatacttcttaaggaggtcgtgttttagaaggaaa       c.*7980

          .         .         .         .         .         .       g.445675
 aggcagaggctatccatcattatgctggctagatgcgcttctgaagaagccggattctga       c.*8040

          .         .         .         .         .         .       g.445735
 tgttcttaaccaaaatggtgaggtcatggaagtcccatttgcttggagattttgaaaaaa       c.*8100

          .         .         .         .         .         .       g.445795
 aaaaaaaaaaaaaacccattcccataaagtaattgagttcagcctttggattatttttgg       c.*8160

          .         .         .         .         .         .       g.445855
 tttggtttttctctggttttgggtgtgatgtaagaagagctttttagttttgttttgaat       c.*8220

          .         .         .         .         .         .       g.445915
 aacatcaatccttgcacactctatgcaaaaattttgtaagcatttcaataatgctatgaa       c.*8280

          .         .         .         .         .         .       g.445975
 ttacaaggaactattttaactttattacactttctgtataaaaaatttgtatttaatatt       c.*8340

          .         .         .         .         .                 g.446033
 atttcgaccacagtcttgtaaaatatattaataaaaataatgattggtaagaaggaaa         c.*8398

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan delta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center