Sarcoglycan beta (SGCB) - coding DNA reference sequence

(used for mutation description)

(last modified December 15, 2009)


This file was created to facilitate the description of sequence variants in the SGCB gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008891.1, covering SGCB transcript NM_000232.4.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
 .         .         .         .         .         .                g.60
 gcggtcgcggaggggcgggcacagtcgggcggggagctcggcggcggcgggcgcgggaag       c.-1

          .         .         .    | 02    .         .         .    g.4706
 ATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAG | CAAAGTTCCAATGGTCCTGTAAAGAAG    c.60
 M  A  A  A  A  A  A  A  A  E  Q   | Q  S  S  N  G  P  V  K  K      p.20

          .         .         .         .         .         .       g.4766
 TCCATGCGTGAGAAGGCTGTTGAGAGAAGGAGTGTCAATAAAGAGCACAACAGTAACTTT       c.120
 S  M  R  E  K  A  V  E  R  R  S  V  N  K  E  H  N  S  N  F         p.40

          .         .         .         .         .         .       g.4826
 AAAGCTGGATACATTCCGATTGATGAAGATCGTCTCCACAAAACAGGGTTGAGAGGAAGA       c.180
 K  A  G  Y  I  P  I  D  E  D  R  L  H  K  T  G  L  R  G  R         p.60

          .         .         .         .         .         .       g.4886
 AAGGGCAATTTAGCCATCTGTGTGATTATCCTCTTGTTTATCCTGGCTGTCATCAATTTA       c.240
 K  G  N  L  A  I  C  V  I  I  L  L  F  I  L  A  V  I  N  L         p.80

     | 03    .         .         .         .         .         .    g.8513
 ATA | ATAACACTTGTTATTTGGGCCGTGATTCGCATTGGACCAAATGGCTGTGATAGTATG    c.300
 I   | I  T  L  V  I  W  A  V  I  R  I  G  P  N  G  C  D  S  M      p.100

          .         .         .         .         .         .       g.8573
 GAGTTTCATGAAAGTGGCCTGCTTCGATTTAAGCAAGTATCTGACATGGGAGTGATCCAC       c.360
 E  F  H  E  S  G  L  L  R  F  K  Q  V  S  D  M  G  V  I  H         p.120

          .         .         .         .         .         .       g.8633
 CCTCTTTATAAAAGCACAGTAGGAGGAAGGCGAAATGAAAATTTGGTCATCACTGGCAAC       c.420
 P  L  Y  K  S  T  V  G  G  R  R  N  E  N  L  V  I  T  G  N         p.140

           | 04        .         .         .         .         .    g.9449
 AACCAGCCT | ATTGTTTTTCAGCAAGGGACAACAAAGCTCAGTGTAGAAAACAACAAAACT    c.480
 N  Q  P   | I  V  F  Q  Q  G  T  T  K  L  S  V  E  N  N  K  T      p.160

          .         .         .         .         .         .       g.9509
 TCTATTACAAGTGACATCGGCATGCAGTTTTTTGACCCGAGGACTCAAAATATCTTATTC       c.540
 S  I  T  S  D  I  G  M  Q  F  F  D  P  R  T  Q  N  I  L  F         p.180

          .         .         .         .         .         .       g.9569
 AGCACAGACTATGAAACTCATGAGTTTCATTTGCCAAGTGGAGTGAAAAGTTTGAATGTT       c.600
 S  T  D  Y  E  T  H  E  F  H  L  P  S  G  V  K  S  L  N  V         p.200

          .         .  | 05      .         .         .         .    g.10259
 CAAAAGGCATCTACTGAAAGG | ATTACCAGCAATGCTACCAGTGATTTAAATATAAAAGTT    c.660
 Q  K  A  S  T  E  R   | I  T  S  N  A  T  S  D  L  N  I  K  V      p.220

          .         .         .         .         .         .       g.10319
 GATGGGCGTGCTATTGTGCGTGGAAATGAAGGTGTATTCATTATGGGCAAAACCATTGAA       c.720
 D  G  R  A  I  V  R  G  N  E  G  V  F  I  M  G  K  T  I  E         p.240

          .         .         .    | 06    .         .         .    g.14186
 TTTCACATGGGTGGTAATATGGAGTTAAAGGCG | GAAAACAGTATCATCCTAAATGGATCT    c.780
 F  H  M  G  G  N  M  E  L  K  A   | E  N  S  I  I  L  N  G  S      p.260

          .         .         .         .         .         .       g.14246
 GTGATGGTCAGCACCACCCGCCTACCCAGTTCCTCCAGTGGAGACCAGTTGGGTAGTGGT       c.840
 V  M  V  S  T  T  R  L  P  S  S  S  S  G  D  Q  L  G  S  G         p.280

          .         .         .         .         .         .       g.14306
 GACTGGGTACGCTACAAGCTCTGCATGTGTGCTGATGGGACGCTCTTCAAGGTGCAAGTA       c.900
 D  W  V  R  Y  K  L  C  M  C  A  D  G  T  L  F  K  V  Q  V         p.300

          .         .         .         .         .                 g.14363
 ACCAGCCAGAACATGGGCTGCCAAATCTCAGACAACCCCTGTGGAAACACTCATTAA          c.957
 T  S  Q  N  M  G  C  Q  I  S  D  N  P  C  G  N  T  H  X            p.318

          .         .         .         .         .         .       g.14423
 aagaaccccagaggtcaccaacatgtttatatcttgacttgacttttttatgcatgcaaa       c.*60

          .         .         .         .         .         .       g.14483
 tcattgtttttacagagtttgtgataactcataattattttaatggcagagcactgctgt       c.*120

          .         .         .         .         .         .       g.14543
 atctgttttatggtctacatagttaaaatcttctcagagagcctaaattctaatacattt       c.*180

          .         .         .         .         .         .       g.14603
 tattaatttatactaatcttcatatttactgttctctaaaataattatgagaagcaaata       c.*240

          .         .         .         .         .         .       g.14663
 aaatcaaaagtcatgtttaaagacgtgtttttaaaattccactatcccttttctaaaggt       c.*300

          .         .         .         .         .         .       g.14723
 taaaggtctgaagcagctgtttagattcactgtaagtaaactttggtaactctaatgggg       c.*360

          .         .         .         .         .         .       g.14783
 atagacccacttaagatatttaaaaaggtatggcatcagcgtttcatgctctgcctttta       c.*420

          .         .         .         .         .         .       g.14843
 gcttctaaaaggaaagatgcagatttctagtgcattaagcctgagccatattctcacatg       c.*480

          .         .         .         .         .         .       g.14903
 caagtgaagtcattaaagaactttacatatgtgagatagaaacaatggttccttagtttt       c.*540

          .         .         .         .         .         .       g.14963
 gcactgggaagaaaatattttgtaaaagaatgtttatttgaaataatgataactatcaat       c.*600

          .         .         .         .         .         .       g.15023
 tgttcacaatgtggtggaaattaaaacaccatctcagctttaacttttaaataataatga       c.*660

          .         .         .         .         .         .       g.15083
 taactatctttattgagcatcttctacatcctaggcattgtcctaggcattgcatgttta       c.*720

          .         .         .         .         .         .       g.15143
 tatccccaattctcaccacaaccctgcaagtaggtggtattatccaagttttacccatta       c.*780

          .         .         .         .         .         .       g.15203
 agaaactgaagatcagagaagttaagaaacttgctcaacatcatatagtaagtagcagag       c.*840

          .         .         .         .         .         .       g.15263
 ttgggattggaattcaggcatgactcaaacctggatgtacttgattccaaatgccatgtt       c.*900

          .         .         .         .         .         .       g.15323
 gttttcactctctgcactgactttttaattatttaaaactctagaaagatgaacaaaggt       c.*960

          .         .         .         .         .         .       g.15383
 taatttaaacttacctaagaagatgagaatcaaacaaaacagatatgcttactctagtta       c.*1020

          .         .         .         .         .         .       g.15443
 aaaagaaaataaatctcatgtcagacccagaaaggaccaatcactgtccgattgtaagct       c.*1080

          .         .         .         .         .         .       g.15503
 atgttgggccaattccaaaatattatacgatggagaggtcaaatttacctacttctgagt       c.*1140

          .         .         .         .         .         .       g.15563
 tacctcagtttcccaacaatggaccttggcacactggagtaacaatacataacagagttg       c.*1200

          .         .         .         .         .         .       g.15623
 ccaagatatttataccctcagcactcggggcaacacagtggaaagtggggaggccataga       c.*1260

          .         .         .         .         .         .       g.15683
 cccaaacaagttctttgggccaggcatggcctagtaagtacaccatgcctcgaaaataag       c.*1320

          .         .         .         .         .         .       g.15743
 tccagaagcactggactaaagagtgctaatgcaggaaataatacacataatttttaggta       c.*1380

          .         .         .         .         .         .       g.15803
 aggataataatttatctctgctcctaatattactatcccattgtaattatttataaccct       c.*1440

          .         .         .         .         .         .       g.15863
 caagccagttgatttttaatatatttgattggaaaagaactctctggtattattaagact       c.*1500

          .         .         .         .         .         .       g.15923
 cacacagaatcagggacagggcccccaaaggagtttgctgtaaaataggcagtagagttg       c.*1560

          .         .         .         .         .         .       g.15983
 tggcatgggcccaaccctgcattcaagtgtaacagcattctgtcagggtcactttgaatt       c.*1620

          .         .         .         .         .         .       g.16043
 gtgcacataagaaaaccaatacaaaaaacaatttgtattcaatattgtcacatttctctc       c.*1680

          .         .         .         .         .         .       g.16103
 tggtagaaaaatcaaataccttagagattatgaagtcattaatttatactgaaattggat       c.*1740

          .         .         .         .         .         .       g.16163
 tgacttactacctaacactgagcgctgtttttaaatgaaaagaatgagatttataaccac       c.*1800

          .         .         .         .         .         .       g.16223
 ttgagtgttattgcagtgatatttgaactcatttgaatatattcagtatcatttaatgtc       c.*1860

          .         .         .         .         .         .       g.16283
 tgaattcagaaaaaaatgccgaaatttttattcagatggtccataaattaaattgcatat       c.*1920

          .         .         .         .         .         .       g.16343
 tcattacttatctgctctatttagatttattttaaaagtttatttaagtaaatattttta       c.*1980

          .         .         .         .         .         .       g.16403
 taaaaaccagaaaacactgtattacaaaatattatttattaaatgtagttcaggaaataa       c.*2040

          .         .         .         .         .         .       g.16463
 tctatttttactcttttttgggaaatacttgtgtttttgatacatctccatgaagttctt       c.*2100

          .         .         .         .         .         .       g.16523
 ttgagaggagaggctattttgatgtttttatacaactgaaggttaacagccatagcattt       c.*2160

          .         .         .         .         .         .       g.16583
 tatgatactttacaggtagtcctggctttttccctgaaacataagcttggaaaatctatt       c.*2220

          .         .         .         .         .         .       g.16643
 agaaagcagaacagggcaaactctccattttacttatggcttttctaatttttaattaat       c.*2280

          .         .         .         .         .         .       g.16703
 taatttatttttttgagacagagtcttgttctgtcgccaggctggagtgcagtggcacaa       c.*2340

          .         .         .         .         .         .       g.16763
 tctcggctctcggctcactgcaacctctgcctcccaggttcaagcgattctcctgcctca       c.*2400

          .         .         .         .         .         .       g.16823
 gcctcccgagtacctgggactacaggcatgtgccacagttcccggctaatttttgtattt       c.*2460

          .         .         .         .         .         .       g.16883
 ttagtagagacggggtttcaccatgttggccaggatggtctcaatctcttgacctcgtga       c.*2520

          .         .         .         .         .         .       g.16943
 tctgcctgccttggcctcccaaagtgctgggattacaggtgtgagccaccacgcctggcc       c.*2580

          .         .         .         .         .         .       g.17003
 ggcttatttttatccacagtaaatcttcagcaactcattgtctccaccagatagtatttt       c.*2640

          .         .         .         .         .         .       g.17063
 tctgtaaatgaaatgctgacttcgcctcttcctgctgtatgctcatccctgcactgagca       c.*2700

          .         .         .         .         .         .       g.17123
 cagatatgacaagcagtagccatgggggaggtgggtgacaaagataggaccccgggaggg       c.*2760

          .         .         .         .         .         .       g.17183
 ggcgcaggtacatgctagtttcaattaccacagtattctagagacgggttgcaatgacaa       c.*2820

          .         .         .         .         .         .       g.17243
 ggggggcaaatgaaatcaatgcaagatttcttaataatgggcagacagaaaaatgtaaaa       c.*2880

          .         .         .         .         .         .       g.17303
 ccacacaaaacggactgctgataatattttaaaatatacttatttgtcttctttttgcat       c.*2940

          .         .         .         .         .         .       g.17363
 tgtgaaaaaaacaaaataaattttgtgtgataattttgatgatgaaaggtggaagttcta       c.*3000

          .         .         .         .         .         .       g.17423
 cctagatttgaatgagtgtttttttaagggaatgagaatgtcatggtgctaaacctgaca       c.*3060

          .         .         .         .         .         .       g.17483
 aataagagatcattgaaatgctgaaaattttaacagtcttcttaaaagtattgagggggc       c.*3120

          .         .         .         .         .         .       g.17543
 aaaaattaccaattatggtatacaaaaataagcctataaatgtgtttcacattgctaact       c.*3180

          .         .         .         .         .         .       g.17603
 tgagtttcagttgattcagtttgtaataactagtaatgagcttctgtttacaataaaaat       c.*3240

          .         .                                               g.17625
 tctgtaaattgtttgctgttaa                                             c.*3262

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center