Sarcoglycan alpha (SGCA) - coding DNA reference sequence

(used for mutation description)

(last modified December 15, 2009)


This file was created to facilitate the description of sequence variants in the SGCA gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008889.1, covering SGCA transcript NM_000023.2. Exons 6 and 7 are missing from some transcripts (see NM_001135697.1); exon 9 is rarely alternatively spliced (missing the second half).

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                               .         .         .                g.5036
                         ctctgtcactcaccgggcgggccaggccgggcagcc       c.-1

          .         .         .        | 02.         .         .    g.6386
 ATGGCTGAGACACTCTTCTGGACTCCTCTCCTCGTGG | TTCTCCTGGCAGGGCTGGGGGAC    c.60
 M  A  E  T  L  F  W  T  P  L  L  V  V |   L  L  A  G  L  G  D      p.20

          .         .         .         .         .         .       g.6446
 ACCGAGGCCCAGCAGACCACGCTACACCCACTTGTGGGCCGTGTCTTTGTGCACACCTTG       c.120
 T  E  A  Q  Q  T  T  L  H  P  L  V  G  R  V  F  V  H  T  L         p.40

          .         .         .        | 03.         .         .    g.6600
 GACCATGAGACGTTTCTGAGCCTTCCTGAGCATGTCG | CTGTCCCACCCGCTGTCCACATC    c.180
 D  H  E  T  F  L  S  L  P  E  H  V  A |   V  P  P  A  V  H  I      p.60

          .         .         .         .         .         .       g.6660
 ACCTACCACGCCCACCTCCAGGGACACCCAGACCTGCCCCGGTGGCTCCGCTACACCCAG       c.240
 T  Y  H  A  H  L  Q  G  H  P  D  L  P  R  W  L  R  Y  T  Q         p.80

          .         .         .         .         .         .       g.6720
 CGCAGCCCCCACCACCCTGGCTTCCTCTACGGCTCTGCCACCCCAGAAGATCGTGGGCTC       c.300
 R  S  P  H  H  P  G  F  L  Y  G  S  A  T  P  E  D  R  G  L         p.100

          .   | 04     .         .         .         .         .    g.6990
 CAGGTCATTGAG | GTCACAGCCTACAATCGGGACAGCTTTGATACCACTCGGCAGAGGCTG    c.360
 Q  V  I  E   | V  T  A  Y  N  R  D  S  F  D  T  T  R  Q  R  L      p.120

          .         .      | 05  .         .         .         .    g.7404
 GTGCTGGAGATTGGGGACCCAGAAG | GCCCCCTGCTGCCATACCAAGCCGAGTTCCTGGTG    c.420
 V  L  E  I  G  D  P  E  G |   P  L  L  P  Y  Q  A  E  F  L  V      p.140

          .         .         .         .         .         .       g.7464
 CGCAGCCACGATGCGGAGGAGGTGCTGCCCTCAACACCTGCCAGCCGCTTCCTCTCAGCC       c.480
 R  S  H  D  A  E  E  V  L  P  S  T  P  A  S  R  F  L  S  A         p.160

          .         .         .         .         .         .       g.7524
 TTGGGGGGACTCTGGGAGCCCGGAGAGCTTCAGCTGCTCAACGTCACCTCTGCCTTGGAC       c.540
 L  G  G  L  W  E  P  G  E  L  Q  L  L  N  V  T  S  A  L  D         p.180

          .         .         .         .     | 06   .         .    g.8103
 CGTGGGGGCCGTGTCCCCCTTCCCATTGAGGGCCGAAAAGAAGG | GGTATACATTAAGGTG    c.600
 R  G  G  R  V  P  L  P  I  E  G  R  K  E  G  |  V  Y  I  K  V      p.200

          .         .         .         .         .         .       g.8163
 GGTTCTGCCTCACCTTTTTCTACTTGCCTGAAGATGGTGGCATCCCCCGATAGCCACGCC       c.660
 G  S  A  S  P  F  S  T  C  L  K  M  V  A  S  P  D  S  H  A         p.220

          .         .         .         .         .         .       g.8223
 CGCTGTGCCCAGGGCCAGCCTCCACTTCTGTCTTGCTACGACACCTTGGCACCCCACTTC       c.720
 R  C  A  Q  G  Q  P  P  L  L  S  C  Y  D  T  L  A  P  H  F         p.240

          .         .        | 07.         .         .         .    g.9171
 CGCGTTGACTGGTGCAATGTGACCCTG | GTGGATAAGTCAGTGCCGGAGCCTGCAGATGAG    c.780
 R  V  D  W  C  N  V  T  L   | V  D  K  S  V  P  E  P  A  D  E      p.260

          .         .         .         .         .         .       g.9231
 GTGCCCACCCCAGGTGATGGGATCCTGGAGCATGACCCGTTCTTCTGCCCACCCACTGAG       c.840
 V  P  T  P  G  D  G  I  L  E  H  D  P  F  F  C  P  P  T  E         p.280

          .         .         .         .         .         .       g.9291
 GCCCCAGACCGTGACTTCTTGGTGGATGCTCTGGTCACCCTCCTGGTGCCCCTGCTGGTG       c.900
 A  P  D  R  D  F  L  V  D  A  L  V  T  L  L  V  P  L  L  V         p.300

          .         .         .         .         .       | 08 .    g.9639
 GCCCTGCTTCTCACCTTGCTGCTGGCCTATGTCATGTGCTGCCGGCGGGAGGGAAG | GCTG    c.960
 A  L  L  L  T  L  L  L  A  Y  V  M  C  C  R  R  E  G  R  |  L      p.320

          .         .    | 09    .         .         .         .    g.14289
 AAGAGAGACCTGGCTACCTCCGA | CATCCAGATGGTCCACCACTGCACCATCCACGGGAAC    c.1020
 K  R  D  L  A  T  S  D  |  I  Q  M  V  H  H  C  T  I  H  G  N      p.340

          .         .         .         .         .         .       g.14349
 ACAGAGGAGCTGCGGCAGATGGCGGCCAGCCGCGAGGTGCCCCGGCCACTCTCCACCCTG       c.1080
 T  E  E  L  R  Q  M  A  A  S  R  E  V  P  R  P  L  S  T  L         p.360

          .         .   / 09b    .         .         .         .       g.14409
 CCCATGTTCAATGTGCACACAG / GTGAGCGGCTGCCTCCCCGCGTGGACAGCGCCCAGGTG       c.1140
 P  M  F  N  V  H  T  G /   E  R  L  P  P  R  V  D  S  A  Q  V         p.380

          .         .                                           g.14433
 CCCCTCATTCTGGACCAGCACTGA |                                        c.1165
 P  L  I  L  D  Q  H  X                                          p.387

          .   | 10     .         .         .         .         .    g.14755
 cagcccagccag | tggttccaggtccagccctgacttcatcctcccttctctgtccacacc    c.*60

          .         .         .         .         .         .       g.14815
 acgagtggcacatcccacctgctgattccagctcctggccctcctggaacccaggctcta       c.*120

          .         .         .         .         .         .       g.14875
 aacaagcagggagagggggtggggtggggtgagagtgtgtggagtaaggacattcagaat       c.*180

          .         .         .         .         .                 g.14928
 aaatatctgctgctctgctcaccaattgctgctggcagcctctcccgtcctca              c.*233
                        ^ alternative polyA-addition site


 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Sarcoglycan alpha protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-16 Build 16
2004-2009 Leiden University Medical Center