Selenoprotein 1 (SEPN1) - coding DNA reference sequence

(used for mutation description)

(last modified February 11, 2011)


This file was created to facilitate the description of sequence variants in the SEPN1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_009930.1, covering SEPN1 transcript NM_020451.2. Exon 3 can be differentially spliced (see transcript NM_206926.1).

NOTE: SEPN1 is a selenoprotien, meaning Selenium is incorporated as selenocysteine (U or Sec) at a UGA codon, normally a termination codon (here *127 and *462). The recognition of UGA as a selenocysteine codon requires a secondary structure called SECIS (selenocysteine insertion sequence) that is located in the 3' UTR of the transcript.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
           .         .         .         .         .                g.5055
      ccccgccccgctctttcgcttcccgggccgccggcagccgccgccagccgcagcc       c.-1

          .         .         .         .         .         .       g.5115
 ATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCT       c.60
 M  G  R  A  R  P  G  Q  R  G  P  P  S  P  G  P  A  A  Q  P         p.20

          .         .         .         .         .         .       g.5175
 CCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCC       c.120
 P  A  P  P  R  R  R  A  R  S  L  A  L  L  G  A  L  L  A  A         p.40

          .         .         .         .         .         .       g.5235
 GCCGCTGCCGCCGCCGTCCGGGTCTGCGCCCGCCACGCCGAGGCCCAGGCGGCCGCGCGG       c.180
 A  A  A  A  A  V  R  V  C  A  R  H  A  E  A  Q  A  A  A  R         p.60

     | 02    .         .         .         .         .         .    g.5924
 CAG | GAACTGGCGCTGAAGACCCTGGGGACAGATGGCCTTTTTCTCTTTTCCTCCTTGGAC    c.240
 Q   | E  L  A  L  K  T  L  G  T  D  G  L  F  L  F  S  S  L  D      p.80

          .         .         .         .         .         .       g.5984
 ACTGACGGGGATATGTACATCAGCCCTGAGGAGTTCAAACCCATTGCTGAGAAGCTAACA       c.300
 T  D  G  D  M  Y  I  S  P  E  E  F  K  P  I  A  E  K  L  T         p.100

   | 03      .         .         .         .         .         .    g.6899
 G | GGTCTTGTTCTGTCACCCAGACTGGAGTGCAGTGGTGCAGTCACAGCTCACTGCAGCCT    c.360
 G |   S  C  S  V  T  Q  T  G  V  Q  W  C  S  H  S  S  L  Q  P      p.120
     ^ differentially spliced exon

          .         .         .         .    | 04    .         .    g.9983
 CAACTTCCCTGGCTCAATTGATCCTCCTGCCTCAGCCTCCTGA | GGTCAACTCCCGCGGCC    c.420
 Q  L  P  W  L  N  U  S  S  C  L  S  L  L  R |   S  T  P  A  A      p.140

          .         .         .         .         .         .       g.10043
 AGCTGCGAGGAGGAGGAGTTGCCCCCTGACCCTAGCGAGGAGACGCTCACCATAGAAGCC       c.480
 S  C  E  E  E  E  L  P  P  D  P  S  E  E  T  L  T  I  E  A         p.160

          .         .         .         .         .        | 05.    g.13407
 CGATTCCAGCCTCTGCTCCCGGAGACCATGACCAAGAGCAAAGATGGCTTCCTAGGG | GTC    c.540
 R  F  Q  P  L  L  P  E  T  M  T  K  S  K  D  G  F  L  G   | V      p.180

          .         .         .         .         .         .       g.13467
 TCCCGCCTCGCCCTGTCCGGCCTCCGAAACTGGACAGCCGCCGCCTCACCAAGTGCAGTG       c.600
 S  R  L  A  L  S  G  L  R  N  W  T  A  A  A  S  P  S  A  V         p.200

          .         .         .         .         .         .       g.13527
 TTTGCCACCCGCCACTTCCAGCCCTTCCTTCCCCCGCCAGGCCAGGAGCTGGGTGAGCCC       c.660
 F  A  T  R  H  F  Q  P  F  L  P  P  P  G  Q  E  L  G  E  P         p.220

          .         .         .         .         .         .       g.13587
 TGGTGGATCATCCCCAGTGAGCTGAGCATGTTCACTGGCTACCTGTCCAACAACCGCTTC       c.720
 W  W  I  I  P  S  E  L  S  M  F  T  G  Y  L  S  N  N  R  F         p.240

          .         .        | 06.         .         .         .    g.13883
 TATCCACCGCCGCCCAAGGGCAAGGAG | GTCATCATCCACCGGCTCCTGAGCATGTTCCAC    c.780
 Y  P  P  P  P  K  G  K  E   | V  I  I  H  R  L  L  S  M  F  H      p.260

          .         .         .         .         .         .       g.13943
 CCTCGGCCCTTTGTGAAGACCCGCTTTGCCCCTCAGGGAGCTGTGGCCTGCCTGACTGCC       c.840
 P  R  P  F  V  K  T  R  F  A  P  Q  G  A  V  A  C  L  T  A         p.280

          .         .         .   | 07     .         .         .    g.14535
 ATCAGCGACTTCTACTACACTGTGATGTTCCG | GATCCATGCCGAGTTCCAGCTCAGTGAG    c.900
 I  S  D  F  Y  Y  T  V  M  F  R  |  I  H  A  E  F  Q  L  S  E      p.300

          .         .         .         .         .         .       g.14595
 CCGCCCGACTTCCCCTTTTGGTTCTCCCCTGCTCAGTTCACCGGCCACATCATCCTCTCC       c.960
 P  P  D  F  P  F  W  F  S  P  A  Q  F  T  G  H  I  I  L  S         p.320

          .         .         .         .         . | 08       .    g.16288
 AAAGACGCCACCCACGTCCGCGACTTCCGGCTCTTCGTGCCCAACCACAG | GTCTCTGAAT    c.1020
 K  D  A  T  H  V  R  D  F  R  L  F  V  P  N  H  R  |  S  L  N      p.340

          .         .         .         .         .         .       g.16348
 GTGGACATGGAGTGGCTTTACGGGGCCAGTGAAAGCAGCAACATGGAGGTGGACATCGGC       c.1080
 V  D  M  E  W  L  Y  G  A  S  E  S  S  N  M  E  V  D  I  G         p.360

          .   | 09     .         .         .         .         .    g.16563
 TACATACCCCAG | ATGGAGCTGGAGGCCACGGGCCCCTCTGTGCCCTCCGTGATCCTGGAT    c.1140
 Y  I  P  Q   | M  E  L  E  A  T  G  P  S  V  P  S  V  I  L  D      p.380

          .         .         .         .         .         .       g.16623
 GAGGATGGCAGCATGATCGACAGCCACCTGCCTTCAGGGGAGCCCCTGCAGTTTGTGTTT       c.1200
 E  D  G  S  M  I  D  S  H  L  P  S  G  E  P  L  Q  F  V  F         p.400

          .         .         .         .         .         .       g.16683
 GAGGAGATCAAGTGGCAGCAGGAGCTGAGCTGGGAGGAGGCTGCCCGGCGCCTGGAGGTG       c.1260
 E  E  I  K  W  Q  Q  E  L  S  W  E  E  A  A  R  R  L  E  V         p.420

          .         .  | 10      .         .         .         .    g.17550
 GCCATGTACCCCTTCAAGAAG | GTCTCCTACTTGCCGTTCACTGAGGCCTTCGACCGAGCC    c.1320
 A  M  Y  P  F  K  K   | V  S  Y  L  P  F  T  E  A  F  D  R  A      p.440

          .         .         .         .         .         .       g.17610
 AAGGCTGAGAACAAGCTGGTGCACTCAATCCTGCTGTGGGGGGCCCTGGATGACCAGTCC       c.1380
 K  A  E  N  K  L  V  H  S  I  L  L  W  G  A  L  D  D  Q  S         p.460

         | 11.         .         .         .         .         .    g.18758
 TGCTGAG | GTTCAGGGCGGACTCTCCGGGAGACTGTCCTGGAAAGTTCGCCCATCCTCACC    c.1440
 C  U  G |   S  G  R  T  L  R  E  T  V  L  E  S  S  P  I  L  T      p.480
                 SRE (Sec redefinition element)

          .         .         .         .         .         .       g.18818
 CTGCTCAACGAGAGCTTCATCAGCACCTGGTCCCTGGTGAAGGAGCTGGAGGAACTGCAG       c.1500
 L  L  N  E  S  F  I  S  T  W  S  L  V  K  E  L  E  E  L  Q         p.500

  | 12       .         .         .         .         .         .    g.18961
  | AACAACCAGGAGAACTCGTCCCACCAGAAGCTGGCTGGCCTGCACCTGGAGAAGTACAGC    c.1560
  | N  N  Q  E  N  S  S  H  Q  K  L  A  G  L  H  L  E  K  Y  S      p.520

          .         .         .         .   | 13     .         .    g.20390
 TTCCCCGTGGAGATGATGATCTGCCTGCCCAATGGCACCGTG | GTCCATCACATCAATGCC    c.1620
 F  P  V  E  M  M  I  C  L  P  N  G  T  V   | V  H  H  I  N  A      p.540

          .         .         .         .         .         .       g.20450
 AACTACTTCTTGGACATCACCTCCGTGAAGCCCGAGGAAATCGAGAGCAATCTCTTCAGC       c.1680
 N  Y  F  L  D  I  T  S  V  K  P  E  E  I  E  S  N  L  F  S         p.560

          .         .         .         .         .         .       g.20510
 TTCTCATCCACCTTTGAAGACCCGTCCACGGCCACCTACATGCAGTTCCTGAAGGAGGGA       c.1740
 F  S  S  T  F  E  D  P  S  T  A  T  Y  M  Q  F  L  K  E  G         p.580

          .         .         .                                     g.20543
 CTCCGGCGTGGCCTGCCCCTCCTCCAGCCCTAG                                  c.1773
 L  R  R  G  L  P  L  L  Q  P  *                                    p.590

          .         .         .         .         .         .       g.20603
 agtgcctggacgggatctgatgcacaggcccccacgcctcagagccagagtggtcctcag       c.*60

          .         .         .         .         .         .       g.20663
 cccatttcagactgcagatgccgcccactcccaccccactcctaggctgccttggagggt       c.*120

          .         .         .         .         .         .       g.20723
 acaagatccactgagggtggccaccacagccttggctccatggtggcgggtagacaaggg       c.*180

          .         .         .         .         .         .       g.20783
 atgcctgggctgactgggcagaggaacctctagctctgactgtcactcggctctccctac       c.*240

          .         .         .         .         .         .       g.20843
 ccatttggctctggaagctgcttggcccccccagatcagggcctgggtgaactccctgga       c.*300

          .         .         .         .         .         .       g.20903
 cctttcctagccagccgcacagtctaggcccttgtggggtgaagaatggagggaggagca       c.*360

          .         .         .         .         .         .       g.20963
 ggctaggaagacggggccaccaccctctccttgctttcagcccttcccacaggaaacatc       c.*420

          .         .         .         .         .         .       g.21023
 aagaagccccagccaggaggggccaggctgccaaggcggctcccctgtttatctagagcc       c.*480

          .         .         .         .         .         .       g.21083
 ttcgttcctggccataccccggactgccctcctgtgcctgatgtccccagctggggtcag       c.*540

          .         .         .         .         .         .       g.21143
 tctcaacaggagccagtcttctggagcctctgggcagaaccctccatcagagtggaaatc       c.*600

          .         .         .         .         .         .       g.21203
 agacgggaccccctgcagcttccctgaccacgccactgaccagctatctggggaagttta       c.*660

          .         .         .         .         .         .       g.21263
 ctgtgaaggggtttctgcctttagcaatggggttcactaagggggttcccgaggcccagg       c.*720

          .         .         .         .         .         .       g.21323
 gccaaggcactcccaccgcctaccttagcacagggtctctgcaggactgcgggagccagc       c.*780

          .         .         .         .         .         .       g.21383
 gctcctgccgcccctcttgcccctcagaccttgcatccacagaagcacaacccagccaaa       c.*840

          .         .         .         .         .         .       g.21443
 caccacagccttctccagagccggcactgtcccggcaaccaggggtgccccaggctagct       c.*900

          .         .         .         .         .         .       g.21503
 cttctacctctggggcaccacggactccccttggccactcttgggactttggtccacgtc       c.*960

          .         .         .         .         .         .       g.21563
 ctgagccactgaccacggccagtctctctttttatatgtgcagaaaagtgtttttacaca       c.*1020

          .         .         .         .         .         .       g.21623
 aactttctcatggtttgtaggtatttttttataaccccagtgctgaggagaaaggagggg       c.*1080

          .         .         .         .         .         .       g.21683
 cagtggcttccccggcagcagccccatgatggctgaatccgaaatcctcgatgggtccag       c.*1140

          .         .         .         .         .         .       g.21743
 cttgatgtctttgcagctgcacctatgggaagaagtagtcctctcttccttctcctcttc       c.*1200

          .         .         .         .         .         .       g.21803
 agctttttaaaaacagtcctcagaggatccatgatccccagcactgtcccatcctccaca       c.*1260

          .         .         .         .         .         .       g.21863
 aaggcccacaggcatgcctgtactctctttcattaaggtcttgaagtcaggctgccccct       c.*1320

          .         .         .         .         .         .       g.21923
 ccccagcccccagttctctccccaccccctcaccccacccggggctcactcagcctggca       c.*1380

          .         .         .         .         .         .       g.21983
 gaggaagaaggaaggcagacatctccgcagccactcctgggccttttatgtgccgagtta       c.*1440

          .         .         .         .         .         .       g.22043
 ccccacttgccttgggcgtgtccactgagccttccccagccagtcttgttctcaattttg       c.*1500

          .         .         .         .         .         .       g.22103
 ttttgttttgttttgagacggagtcttgctctgtcacccaggctggagtgctatggctcg       c.*1560

          .         .         .         .         .         .       g.22163
 atcttggctcactgcaacctccacctcccaggttcaagcaattctcttgcctcagcctcc       c.*1620

          .         .         .         .         .         .       g.22223
 cgagtagctgggattacaggtgcatgccaccatggctggctaatttttgtatttttagta       c.*1680

          .         .         .         .         .         .       g.22283
 gagatggggtttcaccatattggtcaggctgatctggaacttctgacctcaggtgatcca       c.*1740

          .         .         .         .         .         .       g.22343
 cctgcctcagcctcccaaagtgctgggattacaggcgtgagcaatcgtgcccagccttgt       c.*1800

          .         .         .         .         .         .       g.22403
 tcttaattttgtatcatccagtcatcgctaatattacacgcaccttctcacttaatcctc       c.*1860

          .         .         .         .         .         .       g.22463
 acgacaagcctgtgaggcagatgctcattgttcccatcttgatgaaacttgagtctcagg       c.*1920

          .         .         .         .         .         .       g.22523
 gaagtgaagtgacttgcccagggtcactcaggtagagttgagattcaaacccacatgtgg       c.*1980

          .         .         .         .         .         .       g.22583
 ctccaaagtctgcatctggatttgggggtgttttttggcatggcaccctcacctctctcc       c.*2040

          .         .         .         .         .         .       g.22643
 ctgcctgttttccccaaagtggaaaggaaggcctttcaaaccagagtgtctcactcccct       c.*2100

          .         .         .         .         .         .       g.22703
 ctgacctccagaccagatggggcatgagccagccagctcagccaggctccctgtgtcctg       c.*2160

          .         .         .         .         .         .       g.22763
 ggaggaagtgtccccatcccccatgccccttatggggagggagggcgtctgatgctctct       c.*2220

          .         .         .         .         .         .       g.22823
 ctctgcctccccccccatcctgtcaggcacaggtgacgggggcagcccatgcgagccctt       c.*2280

          .         .         .         .         .         .       g.22883
 ctcctgctgctctgggagggccagttccacattgagccagcctggtcccatggaaaatga       c.*2340

          .         .         .         .         .         .       g.22943
 tggcctgggctttctgaggccttatctgatgcctctgcagttcatgtcccccaccaggcc       c.*2400

          .         .         .         .         .         .       g.23003
 tcgaggctcagggtgggagagggccccgggctgccctgtcactcctctaacacttccctc       c.*2460

          .         .         .         .                           g.23047
 ccctgtccccaacatgccctgtaataaaattagagaagactaac                       c.*2504

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Selenoprotein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-20 Build 20
2004-2009 Leiden University Medical Center